IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

[Arabidopsis] Genotyping Saskatoon collection

Kim Zimmerman via arab-gen%40net.bio.net (by kim.zimmerman from uon.edu.au)
Wed Jun 5 01:16:13 EST 2013


I have a question regarding genotyping lines from the Saskatoon collection of Arabidopsis insertional mutants (Robinson et al (2009) An archived activation tagged population of Arabidopsis thaliana to facilitate forward genetics approaches. BMC, 9:101).

Do you use their "sequencing primer" pSKTAIL-L3 (ATACGACGGATCGTAATTTGTCG) as the "left border" primer as per SALK genotyping?  We have been using this primer along with gene specific left and right border primers (in all possible pairings) but have not been able to amplify any fragments - ie all we get are apparent wild type results, not even heterozygous outcomes.  Am I correct in using the pSKTAIL-L3 primer in this way?  Any advice for genotyping from this collection would be greatly appreciated.

Kim Zimmerman
Graduate Student in Biological Sciences
University of Newcastle
NSW, Australia


More information about the Arab-gen mailing list

Send comments to us at biosci-help [At] net.bio.net