IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

[Arabidopsis] Re: CaMV35S min promoter

chiassond from gmail.com via arab-gen%40net.bio.net (by chiassond from gmail.com)
Tue Jun 9 03:49:53 EST 2015


On Monday, June 8, 2015 at 6:52:06 AM UTC+2, Smith Chiang wrote:
> Hello everyone,
> 
> could anyone tell me the sequence of CaMV35S minimal promoter? I
> searched for a while but failed to know it. I need to know the
> sequence so as to design primers for constructing a vector.
> 
> thanks,
> 
> Smith

I have used the following (contains the omega leader):

CAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGATCTGTATTTTTACAACAATTACCAACAACAACAAACAACAAACAACATTACAATTACTATTTACAATTACA

David



More information about the Arab-gen mailing list

Send comments to us at biosci-help [At] net.bio.net