IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

[Arabidopsis] Re: Arab-gen Digest, Vol 122, Issue 3

Shahzad anjam via arab-gen%40net.bio.net (by shahzadbio from yahoo.com)
Thu Jun 11 04:58:25 EST 2015


Hi,I am looking for some cDNA/genomic gene (over)expressing transgenic lines of Arabidopsis. Please someone can me guide me if there is any database where already created transgenic lines of Arabidopsis are available.I have seen the following link, but it contains, 3961 entries which are not arranged according to locus. It consists of many pages and I could not found any search box.https://www.arabidopsis.org/abrc/catalog/unknown_individ_1.html

Can any one guide me how to find such lines.
Best RegardsShahzad
 


     On Wednesday, 10 June 2015, 19:05, "arab-gen-request from oat.bio.indiana.edu" <arab-gen-request from oat.bio.indiana.edu> wrote:
   

 Send Arab-gen mailing list submissions to
    arab-gen from net.bio.net

To subscribe or unsubscribe via the World Wide Web, visit
    http://www.bio.net/biomail/listinfo/arab-gen
or, via email, send a message with subject or body 'help' to
    arab-gen-request from net.bio.net

You can reach the person managing the list at
    arab-gen-owner from net.bio.net

When replying, please edit your Subject line so it is more specific
than "Re: Contents of Arab-gen digest..."


Today's Topics:

  1. Re: CaMV35S min promoter (ashu)
  2. Re: CaMV35S min promoter (chiassond from gmail.com)
  3. Re: CaMV35S min promoter (Bernd Weisshaar)


----------------------------------------------------------------------

Message: 1
Date: Mon, 8 Jun 2015 07:43:41 -0700 (PDT)
From: ashu <ashutosh.biotech from gmail.com>
Subject: [Arabidopsis] Re: CaMV35S min promoter
To: bionet-genome-arabidopsis from moderators.isc.org
Message-ID: <be092142-8772-45f3-aa32-3331f283464e from googlegroups.com>
Content-Type: text/plain; charset=ISO-8859-1

On Monday, June 8, 2015 at 5:52:06 AM UTC+1, Smith Chiang wrote:
> Hello everyone,
> 
> could anyone tell me the sequence of CaMV35S minimal promoter? I
> searched for a while but failed to know it. I need to know the
> sequence so as to design primers for constructing a vector.
> 
> thanks,
> 
> Smith

Hi, 
There are different variants of 35S promoter sequence. Below URL will help you to decide 35S promoter sequence for your work and also look for cross ref to get sequence information.

Cheers
Ashu 
http://blogg.slu.se/forskarbloggen/files/2013/02/GMcrops2012-Podevin.pdf



------------------------------

Message: 2
Date: Tue, 9 Jun 2015 01:49:53 -0700 (PDT)
From: chiassond from gmail.com
Subject: [Arabidopsis] Re: CaMV35S min promoter
To: bionet-genome-arabidopsis from moderators.isc.org
Message-ID: <ee085b38-c559-436e-8bcc-2e760c890284 from googlegroups.com>
Content-Type: text/plain; charset=ISO-8859-1

On Monday, June 8, 2015 at 6:52:06 AM UTC+2, Smith Chiang wrote:
> Hello everyone,
> 
> could anyone tell me the sequence of CaMV35S minimal promoter? I
> searched for a while but failed to know it. I need to know the
> sequence so as to design primers for constructing a vector.
> 
> thanks,
> 
> Smith

I have used the following (contains the omega leader):

CAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGATCTGTATTTTTACAACAATTACCAACAACAACAAACAACAAACAACATTACAATTACTATTTACAATTACA

David



------------------------------

Message: 3
Date: Mon, 8 Jun 2015 09:52:15 +0200
From: Bernd Weisshaar <weisshaa from cebitec.uni-bielefeld.de>
Subject: Re: [Arabidopsis] CaMV35S min promoter
To: Smith Chiang <chiangscn from gmail.com>
Cc: Arab Newsgroup <arab-gen from magpie.bio.indiana.edu>
Message-ID:
    <D315E237-D12E-49A0-B7D6-625810042641 from cebitec.uni-bielefeld.de>
Content-Type: text/plain; charset=us-ascii

Hi,

this is a trip back into history.

You can have a look here:

http://www.genomforschung.uni-bielefeld.de/en/news-history/former-homepage/research/vectors-and-plasmids-at-mpiz-koeln

The vector that might be most helpful is pBT10-GUS
The sequence is linked as a text file in the (very old) CGC format.
Together with the map you should be able to find the sequence you want.

Note that we used (and still use) the -46 to +8 version of the minimal 35S promoter. There is also a -90 version. Some background info is in this old paper:
http://pub.uni-bielefeld.de/publication/1868020
(Recently, SEB allowed to make this old paper publicly available as a PDF which is linked at the URL above.). 

Bests, Bernd


> On 08.06.2015, at 02:27, Smith Chiang <chiangscn from gmail.com> wrote:
> 
> Hello everyone,
> 
> could anyone tell me the sequence of CaMV35S minimal promoter? I
> searched for a while but failed to know it. I need to know the
> sequence so as to design primers for constructing a vector.
> 
> thanks,
> 
> Smith
> 
> _______________________________________________
> Arab-gen mailing list
> Arab-gen from net.bio.net
> http://www.bio.net/biomail/listinfo/arab-gen

______________________________________________
Bielefeld University, CeBiTec & Department of Biology
Prof. Dr. Bernd Weisshaar
Chair of Genome Research / Center for Biotechnology
Universitaetsstrasse 25
33615 Bielefeld
Germany

Office: G0-102
Tel.: +49-521-106-8721
Fax: +49-521-106-6423
genomforschung from uni-bielefeld.de (Secretary)
website: http://www.genomforschung.uni-bielefeld.de/




------------------------------

_______________________________________________
Arab-gen mailing list
Arab-gen from net.bio.net
http://www.bio.net/biomail/listinfo/arab-gen

End of Arab-gen Digest, Vol 122, Issue 3
****************************************


  


More information about the Arab-gen mailing list

Send comments to us at biosci-help [At] net.bio.net