Licor and phage clones

Michelle Michelle
Wed Dec 11 08:49:34 EST 1996



Hi all,

Has anyone out there successfully sequenced lambda phage clones using the
LIcor DNA4000L or similar?  I would like to sequence the ends of my phage
clones using the SP6 and T7 promoters that flank the insert in the vector
I am using (Lambda GEM-11). Any hints, suggestions, protocols etc would be
gratefully received

Thanks!

AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit     Ph  (02)95144043
University of Technology        Fax (02)95144003
Sydney AUSTRALIA
michelle.gleeson at uts.edu.au
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT




More information about the Autoseq mailing list