In reply to Michelle Gleesons posting

Jeff Harford jharford at licor.com
Wed Nov 12 12:35:16 EST 1997





  In reply to:


  To: autoseq at net.bio.net

  Date: Wed, 12 Nov 1997 09:07:17 +1100 (EST)

  From: Michelle Gleeson <michelle at molecule.bio.uts.edu.au>

  Subject: LiCors and PAGE PLUS Acrylamide?

  Hi,


  I just saw a post mentioning use of Amresco`s PAGE PLUS acrylamide as an
  alternative to Long Ranger, on ALF machines. Has anyone out there tried
  this on a LiCor 4000 series (66cm plates)?



AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAA
  A
  Michelle Gleeson
  Molecular Parasitology Unit Ph: (02) 9514 4043
  University of Technology Fax:(02) 9514 4003
  Westbourne St Gore Hill, NSW 2065 michelle.gleeson at uts.edu.au
  When you get to the end of your rope, tie a knot and hang on - FDR

TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTT
  T



  Michelle,

  We typically run Page Plus Acyrylamide here at LI-COR on our 66 cm gels
  (in addition to Long Ranger).  We generally run a 3.75% gel
concentration
  with a 1.2x TBE in the gel and a 1x TBE running buffer at the standard
  electrophoresis parameters.  Typically this will give us 1000-1400 bp
  reads, comparable to the Long Ranger, so if you wanted to try it you
  should be able to get some nice data.  Feel free to contact us at
  biohelp at bio.licor.com  if you have any other questions.

  Jeff Harford
  Product Specialist
  LI-COR Biotech
  4308 Progressive Avenue
  Lincoln, NE  68504
  800-645-4267
  402-467-0700
  jharford at bio.licor.com




More information about the Autoseq mailing list