misc

DNA Services dna_services at cornell.edu
Thu Nov 13 13:04:37 EST 1997


<fontfamily><param>Courier</param><bigger>to purify sequencing reaction
we use the millipore multiscreen system.  We use to use the AGTC 96well
block but we would get big green blobs around 200bp that we could not
get rid of.  The multiscreen is a 96 well format and final cost is
around 40=A2-50=A2 a well and it seems to working out fine for us.


Tom Stelick


</bigger></fontfamily>
AGTATCATGTACCTGACTGACGTAGCTGAATTGGGGGTGACGATTGAG

DNA Sequencing Facility

BioResource Center

157 Biotech Bldg

Cornell University

Ithaca, NY 14853

phone 607-254-4857

fax   607-254-4848

http://brcweb.bio.cornell.edu





More information about the Autoseq mailing list