[Automated-sequencing] pDONR vector

Phillip San Miguel pmiguel at purdue.edu
Tue May 9 13:25:28 EST 2006


Ah yeah. I missed that. If I don't use cross_match correctly I can miss 
large inverted repeats:
  214  1.26 0.00 0.00  pDONR222      359   597 (4121)  C pDONR222 
(1943)  2775  2537 *

C pDONR222  597 GTCGACTACAGGTCACTAATACCATCTAAGTAGTTGATTCATAGTGACTG 548

   pDONR222 2537 GTCGACTACAGGTCACTAATACCATCTAAGTAGTTGATTCATAGTGACTG 2586

C pDONR222  547 GATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCT 498

   pDONR222 2587 GATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCT 2636

C pDONR222  497 AATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCAGCTTTT 448
                                                                  i
   pDONR222 2637 AATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCAGCTTTC 2686

C pDONR222  447 TTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAA 398
                                       i           i
   pDONR222 2687 TTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAA 2736

C pDONR222  397 CGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTG 359

   pDONR222 2737 CGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTG 2775

If the attP1 and attP2 sites are still there after you move your 
fragment of interest, then one issue would be you would need to sequence 
past 200+ bases of known sequence to get to your insert from the vector 
priming sites. (Well, maybe only 125 bases, if you are cloning attB 
flanked PCR products.)
	But instead of forward and reverse vector primers, couldn't Ciaran use 
PCR fragment primers? Something inside the attB sites?

Phillip

Alejandro Gonzalez wrote:
> Hi Ciaran, good morning. Yeah, we have same problems to sequence, but using
> the pDONR201 vector because the same problem with the 2 identical homology
> recombination sites. Invitrogen local support here informed us the problem
> with this 2 large identical homology recombination sites, and they suggested
> the pDONR221vector . We move to pDONR221 Invitrogen's vector, and we improve
> the sequencing performance, it was Ok for us.
> The problem with pDONR222 vector is with 2 recombination sites attB1 and
> attB2 which share near identical homology ?
> 
> Thanks
> 
> Lic. Alejandro D González
> Automatic Sequencing & R&D group.
> Gema Biotech sa
> M.T. de Alvear 2289
> Bs. As., Argentina
> +54-11-4825-8029 (137)
> 
> 
> ----- Original Message -----
> From: "Fulton, Ciaran" <ciaran.Fulton at almac-diagnostics.com>
> To: <autoseq at magpie.bio.indiana.edu>
> Sent: Tuesday, May 09, 2006 4:50 AM
> Subject: [Automated-sequencing] pDONR vector
> 
> 
>> Hi all....we're using the pDONR222 vector for sequencing cDNA inserts from
> libraries generated from the Invitrogen CloneMiner cDNA construction kit.
> Generally we've had no problems with this set-up but we were talking to
> another 3rd party recently who suggested that it might not be the most
> suitable vector for sequencing. It has 2 recombination sites which share
> near identical homology to one another and it has been suggested that if the
> insert is less than 1kb then these can form secondary or hairpin structures,
> essentially denying the primers template to prime off. There is supposed to
> be a Biotechniques article about it somewhere but I haven't been able to
> locate it.
>> Has anyone any similar experiences using this or a derivative vector?
>>
>> Regards,
>>
>>
>> Ciaran
>>
>> Dr. Ciaran Fulton
>> Team Leader
>> Sequencing R&D Group
>>
>> Almac Diagnostics Ltd
>> 19 Seagoe Industrial Estate
>> Craigavon
>> Co Armagh
>> BT63 5QD
>> Northern Ireland
>>
>> Tel ('): +44 (0)28 38 39 57 22
>> Fax (7):  +44 (0)28 38 39 86 76
>> Email (*): ciaran.fulton at almac-diagnostics.com
>>
>>
>> This e-mail is from Almac Diagnostics Ltd
>>
>> The e-mail and any files transmitted with it are confidential and
> privileged and intended solely for the use of the individual or entity to
> whom they are addressed.
>> Any unauthorised direct or indirect dissemination, distribution or copying
> of this message and any attachments is strictly prohibited.
>> If you have received the e-mail in error please notify
> helpdesk at almac-diagnostics.com or telephone +44 28 38 363841 and delete the
> e-mail from your system.
>> E-mail and other communications sent to this company may be reviewed or
> read by persons other than the intended recipient.
>> Viruses : although we have taken steps to ensure that this e-mail and any
> attachments are free from any virus, you should, in keeping with good
> practice, ensure that they are actually virus free.
>> Almac Diagnostics Ltd. Registration Number NI 43067
>>
>> Registered Address :  Almac House, 20 Seagoe Industrial Estate, Craigavon,
> BT63 5QD
>>
>>
>> _______________________________________________
>> Autoseq mailing list
>> Autoseq at net.bio.net
>> http://www.bio.net/biomail/listinfo/autoseq
>>
>>
>>
>> --
>> No virus found in this incoming message.
>> Checked by AVG Free Edition.
>> Version: 7.1.392 / Virus Database: 268.5.5/334 - Release Date: 08/05/2006
>>
>>
> 
> 
> 



More information about the Autoseq mailing list