How about try this, if FASTA Server error!

David Kristofferson kristoff at genbank.BIO.NET
Wed Feb 7 16:03:41 EST 1990


The correct syntax for the FASTA-MAIL server follows.  PLease follow
it precisely.  For complete instructions send a mail message
containing just the word HELP (no Subject line) to
search at genbank.bio.net.


DATALIB GenBank/other_mammalian
KTUP 4
SCORES 100
ALIGNMENTS 20
BEGIN
>BOVPRL GenBank entry BOVPRL from gbmam file.907 nucleotides. 
tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat
caccaccatggacagcaaa
-- 
				Sincerely,

				Dave Kristofferson
				GenBank On-line Service Manager

				kristoff at genbank.bio.net




More information about the Bio-soft mailing list