I need the Staden format.

bioc06 at otago.ac.nz bioc06 at otago.ac.nz
Wed Oct 9 17:01:01 EST 1991


In article <9110071252.AA08988 at genbank.bio.net>, BROE at AARDVARK.UCS.UOKNOR.EDU (Bruce Roe) writes:
> Eric Cabot writes: 
> => 
> => Hi netters,
> =>    Can someone please email or post the format specifications of the
> => sequence files used by Staden's programs?
> => 
> => Thanks,
> => 
> 
> The staden format is plain text with a hard carrage return at the
> end of the line (usually 60 characters long).  There also can be
> a single header line enclosed by less_than greater_than signs.
> The following lines are a typical "staden-format" file.  Note
> that there is nothing at the end of the file as there is with
> other formats.
> 
>  <--puc19.dat-->
>  GACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTT
>  CTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTT
>  TCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAAT
>  AATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTT
>  TTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATG
>  CTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGA
>  TCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGC
>  TATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATAC
>  ACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATG
>  GCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCA
>  ACTTACTTCTGAC
> 
> Cheers,
>  /o o\   \ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /
>    o      X  X  X  X  X  X  X  X  X  X  X  X  X  X  X  X  X  X  X  X  X 
>   \O/    / \/ \/ \/ \/ \/ \/ \/ \/     BROE at aardvark.ucs.uoknor.edu

This is not quite correct.  Some Staden SW has (in the past at least) expected
a @ as an end of sequence marker.

Peter Stockwell




More information about the Bio-soft mailing list