I need the Staden format.

Bruce Roe BROE at AARDVARK.UCS.UOKNOR.EDU
Mon Oct 7 07:52:00 EST 1991


Eric Cabot writes: 
=> 
=> Hi netters,
=>    Can someone please email or post the format specifications of the
=> sequence files used by Staden's programs?
=> 
=> Thanks,
=> 

The staden format is plain text with a hard carrage return at the
end of the line (usually 60 characters long).  There also can be
a single header line enclosed by less_than greater_than signs.
The following lines are a typical "staden-format" file.  Note
that there is nothing at the end of the file as there is with
other formats.

 <--puc19.dat-->
 GACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTT
 CTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTT
 TCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAAT
 AATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTT
 TTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATG
 CTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGA
 TCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGC
 TATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATAC
 ACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATG
 GCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCA
 ACTTACTTCTGAC

Cheers,
 /o o\   \ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /\ /
   o      X  X  X  X  X  X  X  X  X  X  X  X  X  X  X  X  X  X  X  X  X 
  \O/    / \/ \/ \/ \/ \/ \/ \/ \/     BROE at aardvark.ucs.uoknor.edu





More information about the Bio-soft mailing list