I need the Staden format.

Bruce Roe BROE at AARDVARK.UCS.UOKNOR.EDU
Thu Oct 10 06:05:00 EST 1991


=> In article <9110071252.AA08988 at genbank.bio.net>, BROE at AARDVARK.UCS.UOKNOR.EDU (Bruce Roe) writes:
=> > Eric Cabot writes: 
=> > => 
=> > => Hi netters,
=> > =>    Can someone please email or post the format specifications of the
=> > => sequence files used by Staden's programs?
=> > => 
=> > => Thanks,
=> > => 

and I replied

=> > 
=> > The staden format is plain text with a hard carrage return at the
=> > end of the line (usually 60 characters long).  There also can be
=> > a single header line enclosed by less_than greater_than signs.
=> > The following lines are a typical "staden-format" file.  Note
=> > that there is nothing at the end of the file as there is with
=> > other formats.
=> > 
=> >  <--puc19.dat-->
=> >  GACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTT
=> >  CTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTT
=> >  TCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAAT
=> >  AATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTT
=> >  TTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATG
=> >  CTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGA
=> >  TCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGC
=> >  TATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATAC
=> >  ACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATG
=> >  GCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCA
=> >  ACTTACTTCTGAC
=> > 

Then Peter Stockwell posted:

=> This is not quite correct.  Some Staden SW has (in the past at least)
=> expected a @ as an end of sequence marker.
=> 
=> Peter Stockwell
=> 

Sorry Peter,
But when you enter gel readings in one of the Staden programs,
from the early versions of BATIN to the latest SAP programs,
you "type" a @ to indicate to the FORTRAN program that the sequence
entry is complete, but the @ IS NOT included at the end of the sequence
file.  The file I sent above is a copy of a Staden Program produced
data file EXACTLY as found on our VAX.

-- Bruce Roe
   broe at aardvark.ucs.uoknor.edu




More information about the Bio-soft mailing list