Searching for Palindromes, direct/inverted repeats

[Eric E. Snyder]

I am looking for a program that will detect palindromes,
inverted or direct repeats in a given DNA sequence.  Does
any one have or know where I could find such a program?

I am interested in detecting such sequences in that might 
be involved in site-specific recombination events in 
ciliates, FYI, ICYC.

(posting for a friend, smansour at boulder.colorado.edu)
Thanx,

---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder                            
Department of MCD Biology              ...making feet for childrens' shoes.
University of Colorado, Boulder   
Boulder, Colorado 80309-0347
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------