Primer summary
Dan Jacobson
danj at WELCHGATE.WELCH.JHU.EDU
Mon Apr 13 10:52:43 EST 1992
I have had enough requests for information on the primer programs to warrant
a repost. The string can pretty much be boiled down to what I`ve included here.
The first two parts are descriptions of the two Primer programs that I know
one can obtain by ftp. Most of the string was about the program available
from the Whitehead Institute (WI). Note that this program is ftp`able only
as the C source code, last I checked there were not any execs on the WI server
(I checked Friday). There are instructions on getting execs on a disk from
WI included in the first article. Also included is a summary dealing with
the compilation of PRIMER on a Mac, Bruce Roe was working with the authors
to make a Mac exec available by ftp but as of yet I haven't seen one so I
assume that it's still being worked on.
Hope this helps,
Dan Jacobson
danj at welchgate.welch.jhu.edu
--------------------------------------------------------------------------------
A request was made for a program which will design PCR primers.
I have included the README file from the PRIMER program available via anonymous
ftp from genome.wi.edu. Instructions for obtaining the program on disks are
included in the appended information. PRIMER comes with a pretty extensive man
ual and is pretty user friendly. I'll leave the rest to the following file.
SIncerely,
Dan Jacobson
danj at jhuhyg.sph.jhu.edu
==========================================================================
PRIMER 0.5: Questions and Answers
What exactly is PRIMER?
PRIMER is a computer program for automatically selecting PCR primers. PRIMER te
PRIMER was written by Steve Lincoln, Mark Daly, and Eric Lander at the MIT Cente
What types of computers does PRIMER run on?
In short: just about anything which supports a standard C language compiler, inc
(1) IBM PC and compatibles. A PC/AT (286) class machine or better with 640K of
(2) Apple Macintosh computers. A Mac II series or SE/30 with a math coprocessor
(3) Most Unix workstations including Sun SPARCStation and DEC DECStation systems
(4) DEC VAX/VMS computers under VMS Version 5 with VAX C.
How do I get PRIMER?
PRIMER is available from a number of sources:
(A) You can get PRIMER from another user, provided you strictly follow the terms
(B) You can download the most recent version off the Internet via anonymous FTP
(C) You can send a request to:
"PRIMER c/o The Lander Lab,
Whitehead Institute/MIT
9 Cambridge Center, Cambridge, MA 02142.
Email to "primer at genome.wi.edu" (Internet), or FAX to 617-258-6505
Request a copy of PRIMER, specifying a 3 1/2" floppy disk for either SPARCStatio
Do I really need to compile PRIMER myself, and if so, how?
If you receive a ready-to-run version from us or another user, then you do not.
The C source code we distribute may be compiled using:
(1) Microsoft C 4.0 on IBM PC compatibles. The file MAKEPC.BAT included execute
(2) Apple Macintosh computers with ThinkC 4.0.1. A ThinkC project file has been
(3) DEC VAX/VMS computers under VAX C with VMS 5.x. The file MAKEVAX.COM includ
may have to change the linking procedure depending on your system's configuratio
(4) Unix workstations including Sun SPARCStation and DEC DECStation Systems with
Before compiling the program, you may need to modify configuration information i
What's the fine print?
PRIMER and its documentation are copyright 1991 by the Whitehead Institute for B
PRIMER is available for free use for non-commercial purposes by basic research l
PRIMER may be freely redistributed to other scientists, provided that all of the
Primer is designed to select primers for PCR applications, although it may may a
PRIMER is supplied without any warranty or guaranteed support whatsoever. The W
WHAT ARE ALL THESE FILES WHICH CAME WITH PRIMER?
They are:
File Description
---- -----------
primer.c PRIMER C Source Code
text.c PRIMER C Source Code
primer.h PRIMER C Source Code
sample.seq Sample Input Sequence File
sample2.seq Longer Sample Input Sequence File
standard.cri Sample PCR Primer Criteria File
sample.rep Sample Repeat Sequence File (Human Alu only)
mouse.rep Sample Repeat Sequence File (Mouse Sequences)
rat.rep Sample Repeat Sequence File (Rat Sequences)
human.rep Sample Repeat Sequence File (Human Sequences)
manual.txt PRIMER Manual text file (no line breaks)
manual.asc PRIMER Manual text file (with line breaks)
readme.txt This Document (text file, no line breaks)
readme.asc This Document (text file, with line breaks)
makepc.bat DOS Batch file to compile PRIMER
makevax.com VAX/VMS Command file to compile PRIMER
makefile Unix Makefile to compile PRIMER
Other files which may be included with specific versions include:
File Description
---- -----------
primer PRIMER Executable for Sun SPARCStations
primer.exe PRIMER Executable for PC Compatibles
PRIMER PRIMER Executable for Macintosh
PRIMER Manual PRIMER Manual (Mac Microsoft Word 4.0 Format)
The PRIMER Manual PRIMER Manual (Macintosh Executable)
PRIMER README This Document (Mac Microsoft Word 4.0 Format)
The PRIMER README This Document (Macintosh Executable)
Remember, to legally redistribute PRIMER to anyone else, you must give them unmo
-------------------------------------------
Steve Lincoln and Mark Daly
MIT Center for Genome Research
Whitehead Institute for Biomedical Research
9 Cambridge Center, Cambridge, MA 02142
primer at genome.wi.edu, FAX: 617-258-6505
================================================================================
////////////////////////////////////////////////////////////////////////////////
================================================================================
A request was made for information about PCR Primer programs other than the
one from the Whitehead institute. Well here's the readme file from the
other prgram availble over the net. I have no information about the commercial
programs.
Sincerely,
Dan Jacobson
danj at jhuhyg.sph.jhu.edu
=======================================================================
The program 'primer' is written by Don Faulkner. It helps to find potential
mispriming sites (primer sequences should be designed before running the
program!). The program allows to give higher weights to matches at the 3'
end of the primer, linearly decreasing them towards the 5' end (the default
is weight=10 for 3' nucleotide decreasing to 1 at nucleotide # 8 from the 3'
end). The program can be used when amplifying *long* fragments from a known
sequence.
The program is written in "C" and runs on Sun workstation (Unix).
To get the program running:
%ftp 36.45.0.126 or jmullins.stanford.edu
logon: anonymous
send your ID as a passwd
cd pub
set binary
get primer.tar
....
%tar xvf primer.tar
%make primer
%primer
... and you should get the sample run, presented below.
List of files:
-rw-rw-rw- 1 gene 532 Apr 8 18:33 Makefile
-rw-rw-rw- 1 gene 1527 Apr 8 17:25 backup.c
-rw-rw-rw- 1 gene 14226 Apr 8 17:16 clib.c
-rw-rw-rw- 1 gene 6174 May 7 1990 dynamic.c
-rw-rw-rw- 1 gene 208 May 7 1990 dynamic.h
-rw-rw-rw- 1 gene 2999 Apr 8 17:23 faulkn.h
-rw-rw-rw- 1 gene 208 May 7 1990 free.c
-rw-rw-rw- 1 gene 5328 May 7 1990 get-matrix.c
-rw-rw-rw- 1 gene 580 May 8 1990 hello.c
-rw-rw-rw- 1 gene 6679 Jun 5 1990 main.c
-rw-rw-rw- 1 gene 245 May 7 1990 matrix-test.c
-rw-rw-rw- 1 gene 8609 Apr 8 17:27 name-expander.c
-rw-rw-rw- 1 gene 1145 Apr 8 17:25 nread.c
-rw-rw-rw- 1 gene 4549 Apr 8 17:16 open_file.c
-rw-rw-rw- 1 gene 1629 May 11 1990 position-mat.c
-rw-rw-rw- 1 gene 8094 May 11 1990 rdseq.c
The file
-rw-r--r-- 1 gene 229 Apr 8 18:16 matrix
has the following:
actg ; this is the character set
match = 2
close = match / 2
missm = -match
;a c t g
match missm missm missm ;a
missm match missm missm ;c
missm missm match close ;t
missm missm close match ;g
These are sample files with several primer sequences and long template:
-rw-rw-rw- 1 gene 89 May 11 1990 3_primers
-rw-rw-rw- 1 gene 26769 May 11 1990 hxb-inv.seq
-rw-r--r-- 1 gene 40 Apr 8 17:31 .primer
Sample run is below:
%primer
*********************
* *
* DYNAMIC PRIMERS *
* *
*********************
Parameters for this search will be taken from
the previous one you made
OR you can specify new parameters.
Weighted search using the Dynamic Programming Algorighm
Gap Penalty, or <CR> for -2.000000 ->
LARGE sequence:
Enter name of file containing query
sequence, or <CR> for hxb-inv.seq ->
Locus names in the file <hxb-inv.seq>:
HXB2-INV
Enter locus name of query sequence, or <CR> for HXB2-INV ->
9719 bases found for locus HXB2-INV in file hxb-inv.seq
PRIMER sequence:
Enter name of file containing query
sequence, or <CR> for 3_primers ->
Locus names in the file <3_primers>:
sbc4
sbc5
sbc6
Enter locus name of query sequence, or <CR> for sbc4 ->
19 bases found for locus sbc4 in file 3_primers
Locus "HXB2-INV" (len = 9719) against "sbc4" (len = 19)
Position weighting matrix:
Default is Val=1 from 5' end to position (length-8)
linearly increasing to Val=10 at the 3' end of the primer.
If you want to CHANGE it enter 'y'
Output file:
File to write to -> test
2391 maxima
#1 score 95.875, 1 gap
4840 AATTTG-TTTTTGTAATTC
****. *.*******
1 CATTTTCCAATGGTAATTC
#2 score 95.125, 2 gaps
671 CAGCTGCC--TTGTAAGTC
**. *.** *.****.**
1 CATTTTCCAATGGTAATTC
#3 score 93.625, 4 gaps
5058 GATTGT---A-GGGAATTC
***.* * **.*****
1 CATTTTCCAATGGTAATTC
#4 score 93.625, 4 gaps
5008 AATTTT-C---TTTAATTC
***** * ..******
1 CATTTTCCAATGGTAATTC
#5 score 91.000, 3 gaps
8876 TTTTTTCCCATCGATCTAATTC
IT CHAR ****** ** * . ******
1 CATTTTCCAAT-G-G-TAATTC
#6 score 90.000, 5 gaps
1156 CCT
More information about the Bio-soft
mailing list