EPD is now available for searching via Gopher

Dan Jacobson danj at welchgate.welch.jhu.edu
Mon Dec 7 15:19:26 EST 1992


The Eukaryotic Promoter Database (EPD) is now available for searching via 
Gopher.  I have taken the version of EPD that contains a codified header and 
the sequence of the promoter and translated the header into english so that 
it can be searched for keywords.  For example:

>EPD16010 (-) Gm RuBPCss SRS4; range -499 to 100.

Now becomes - 

EPD16010 (-) Glycine max (soybean) Ribulose-1,5-biphosphate carboxylase small 
subunit SRS4; range -499 to 100.



So a typical entry looks like the following:

>EPD07005 (-) Glycine max (soybean) Ribulose-1,5-biphosphate carboxylase small
subunit; range -499 to 100.
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCTCCGAGAGGAATGAATAATGGAACCTCCATGTGTCACCTC
CTCATATGGTATCCAACAATAAGGCTACCATTCGAAAATTTTCCTCGACTCGTGTGGCCT
ATATGCTGTAATGTCATCACTTATTCGAATCCAACGGTTGTAACTTTTCGGCAACCAATC
CTCTCCATTTCACACCATTGGATTAGTACTACACAAATCGACACTATTATATATAGCAAG
TTTGAGCAGAAGCTTGGATATCTGGCAGCAGAAAAACAAGTAGTTGAGAACTAAGAAGAA
GAAAATGGCTTCCTCAATGATCTCCTCCCCAGCTGTTACCACCGTCAACCGTGCCGGTGC
//


===============================================================================




More information about the Bio-soft mailing list