Using PRIMER-- a software selecting primers

Dan Jacobson danj at welchgate.welch.jhu.edu
Thu Mar 4 09:23:41 EST 1993


In article <930302110524.2051 at VTHVAX.TAMU.EDU> MCAO at VTHVAX.TAMU.EDU writes:
>Hi, Do you know where to get this kind of software from public domain? I would like to get one for primer design.
>
>						Ming Cao
>


There are, to my knowledge 4 programs which deal with pcr primer
construction which one can obtain by anonymous ftp and one which 
will be mailed to you by the author.
The programs are listed below in no particular order.

Pgen - for Dos only
Primer - Stanford - Sun Sparcstations only
Primer - Whitehead -Unix, Vms, DOS (and Mac if you can compile it)
Amplify - Mac only

OSP - Unix, X-windows, Vms, DOS, Mac - by snail-mail only.

Below is all the info I have on said programs.

Hope this helps,

Dan Jacobson

Kudos go to the authors and the ftp site maintainers.
-------------------------------------------------------------------------

Pgen

An excerpt from the PrimerGen's documentation:

PrimerGen searches strings of amino acid residues in order to reverse-translate
oligonucletide primers of a desired range of lengths and maximum number of
degeneracies.

PrimerGen only works on IBM-PC(TM), XT, AT, PS/2 and compatibles with
EGA or VGA graphics adaptors.  It will not work on computers with CGA or
Hercules(TM) graphics cards.  This is because the program alters the
screen fonts which cannot be done on the latter types of graphics
adaptors.  I have no access to XGA card-driven computers, so I don't
know what happens there!  A hard drive is NOT required and PrimerGen will
fit on a 360K 5.25" floppy disk.

You need to input:
	- the appropriate amino acid sequence,
	- the minimum size of desired primers,
	- the maximum size of primers (important for codon preference -
	  generated primers),
	- the maximum acceptable number of mismatches,
	- desired codon preference table (if required).

The program will also supply the melting temperature of the primer. You may
input the Na or K cation concentration used in the melting temperature
calculations.

PrimerGen contains a sequence editor, where amino acid residues are entered.
The amino acid sequence must be ONE fragment and cannot be longer than 70
residues.  The sequence must be in the ONE LETTER CODE and cannot contain
any UNKNOWNS.  After the desired amino acid sequence has been entered have the
option of saving the sequence to a disk.  PrimerGen will also accept and
re-edit previously saved sequence files, and also contains a codon preference
table editor.


anonymous ftp from ftp.bio.indiana.edu in the molbio/ibmpc directory.

============================================================================
////////////////////////////////////////////////////////////////////////////
============================================================================
Priner - Stanford 

The program 'primer' is written by Don Faulkner. It helps to find potential
mispriming sites (primer sequences should be designed before running the
program!).  The program allows to give higher weights to matches at the 3'
end of the primer, linearly decreasing them towards the 5' end (the default
is weight=10 for 3' nucleotide decreasing to 1 at nucleotide # 8 from the 3'
end). The program can be used when amplifying *long* fragments from a known
sequence.

The program is written in "C" and runs on Sun workstation (Unix).
To get the program running:
%ftp 36.45.0.126          or jmullins.stanford.edu
logon: anonymous
send your ID as a passwd
cd pub
set binary
get primer.tar
....
%tar xvf primer.tar
%make primer
%primer
... and you should get the sample run, presented below.

List of files:
-rw-rw-rw-  1 gene          532 Apr  8 18:33 Makefile
-rw-rw-rw-  1 gene         1527 Apr  8 17:25 backup.c
-rw-rw-rw-  1 gene        14226 Apr  8 17:16 clib.c
-rw-rw-rw-  1 gene         6174 May  7  1990 dynamic.c
-rw-rw-rw-  1 gene          208 May  7  1990 dynamic.h
-rw-rw-rw-  1 gene         2999 Apr  8 17:23 faulkn.h
-rw-rw-rw-  1 gene          208 May  7  1990 free.c
-rw-rw-rw-  1 gene         5328 May  7  1990 get-matrix.c
-rw-rw-rw-  1 gene          580 May  8  1990 hello.c
-rw-rw-rw-  1 gene         6679 Jun  5  1990 main.c
-rw-rw-rw-  1 gene          245 May  7  1990 matrix-test.c
-rw-rw-rw-  1 gene         8609 Apr  8 17:27 name-expander.c
-rw-rw-rw-  1 gene         1145 Apr  8 17:25 nread.c
-rw-rw-rw-  1 gene         4549 Apr  8 17:16 open_file.c
-rw-rw-rw-  1 gene         1629 May 11  1990 position-mat.c
-rw-rw-rw-  1 gene         8094 May 11  1990 rdseq.c



The file
-rw-r--r--  1 gene          229 Apr  8 18:16 matrix
has the following:
actg ; this is the character set
match = 2
close = match / 2
missm = -match
;a      c      t      g
 match  missm  missm  missm  ;a
 missm  match  missm  missm  ;c
 missm  missm  match  close  ;t
 missm  missm  close  match  ;g


These are sample files with several primer sequences and long template:
-rw-rw-rw-  1 gene           89 May 11  1990 3_primers
-rw-rw-rw-  1 gene        26769 May 11  1990 hxb-inv.seq
-rw-r--r--  1 gene           40 Apr  8 17:31 .primer

Sample run is below:

%primer
         *********************
         *                   *
         *  DYNAMIC PRIMERS  *
         *                   *
         *********************

Parameters for this search will be taken from
the previous one you made
OR you can specify new parameters.

Weighted search using the Dynamic Programming Algorighm

Gap Penalty, or <CR> for -2.000000 ->

LARGE sequence:
Enter name of file containing query
  sequence, or <CR> for hxb-inv.seq ->

Locus names in the file <hxb-inv.seq>:
                                        HXB2-INV

Enter locus name of query sequence, or <CR> for HXB2-INV ->


9719 bases found for locus HXB2-INV in file hxb-inv.seq


PRIMER sequence:
Enter name of file containing query
  sequence, or <CR> for 3_primers ->

Locus names in the file <3_primers>:
                                        sbc4
                                        sbc5
                                        sbc6

Enter locus name of query sequence, or <CR> for sbc4 ->


19 bases found for locus sbc4 in file 3_primers

Locus "HXB2-INV" (len = 9719) against "sbc4" (len = 19)

Position weighting matrix:
Default is  Val=1 from 5' end to position (length-8)
linearly increasing to Val=10 at the 3' end of the primer.
If you want to CHANGE it enter 'y'

Output file:
File to write to -> test
2391 maxima

#1 score  95.875, 1 gap
     4840 AATTTG-TTTTTGTAATTC
           ****.    *.*******
        1 CATTTTCCAATGGTAATTC

#2 score  95.125, 2 gaps
      671 CAGCTGCC--TTGTAAGTC
          **. *.**  *.****.**
        1 CATTTTCCAATGGTAATTC

#3 score  93.625, 4 gaps
     5058 GATTGT---A-GGGAATTC
           ***.*   * **.*****
        1 CATTTTCCAATGGTAATTC

#4 score  93.625, 4 gaps
     5008 AATTTT-C---TTTAATTC
           ***** *   ..******
        1 CATTTTCCAATGGTAATTC

#5 score  91.000, 3 gaps
     8876 TTTTTTCCCATCGATCTAATTC
   IT CHAR          ****** ** * . ******
        1 CATTTTCCAAT-G-G-TAATTC

#6 score  90.000, 5 gaps
     1156 CCTCGTTACAATCAAGAGTAAGTC
          * * .** ****   * ****.**
        1 CAT-TTTCCAAT---G-GTAATTC

#7 score  89.875, 3 gaps
     1493 C-TTGCCCATTTATCTAATTC
          * **. *** *. . ******
        1 CATTTTCCAATG-G-TAATTC

#8 score  89.250, 4 gaps
     6519 C-TGGT---GTGGTAAGTC
          * *..*    ******.**
        1 CATTTTCCAATGGTAATTC

#9 score  87.500, 3 gaps
     1577 C-TTGTGTAATTGTTAATTTC
          * **.*  ** **.*** ***
        1 CATTTTCCAA-TGGTAA-TTC

#10 score  87.375, 4 gaps
     6575 CTATGCTGCCCTATTTCTAAGTC
          * **. *. ** **.. ***.**
        1 C-ATT-TT-CCAATGG-TAATTC

#11 score  87.000, 5 gaps
     2724 GAGTTGATACTACTGGCCTAATTC
           * **. * * * ***  ******
        1 CA-TTT-T-CCAATGG--TAATTC

If you want to continue press 'y'
10 scores above threshold, 11 unique paths printed

Another PRIMER with sequence 'HXB2-INV' - press 'y'
If you want to INVERT the LARGE sequence - press 'i' i
Sequence 'HXB2-INV' has been inverted


PRIMER sequence:
Enter name of file containing query
  sequence, or <CR> for 3_primers ->

Locus names in the file <3_primers>:
                                        sbc4
                                        sbc5
                                        sbc6

Enter locus name of query sequence, or <CR> for sbc4 ->


19 bases found for locus sbc4 in file 3_primers

Locus "HXB2-INV_INVERTED" (len = 9719) against "sbc4" (len = 19)

Position weighting matrix:
Default is  Val=1 from 5' end to position (length-8)
linearly increasing to Val=10 at the 3' end of the primer.
If you want to CHANGE it enter 'y'

Output file: test
File exists: Overwrite, Append, Reenter,
    or Backup, or <CR> for Append ->
2372 maxima

#1 score 100.875, 0 gaps
     7365 AATTTTTCTACTGTAATTC
           ***** * * .*******
        1 CATTTTCCAATGGTAATTC

#2 score  93.500, 3 gaps
     9082 GACTGG--AAGGGCTAATTC
           * *..  **.** ******
        1 CATTTTCCAATGG-TAATTC

#3 score  92.500, 5 gaps
     4637 CA--GG--AATTTGGAATTC
          **  ..  ** *.*.*****
        1 CATTTTCCAA-TGGTAATTC

#4 score  89.625, 3 gaps
     8043 C-TGTGCC--TTGGAATGC
          * *.*.**  *.*.***.*
        1 CATTTTCCAATGGTAATTC

#5 score  89.500, 3 gaps
        1 ---TGG--AAGGGCTAATTC
             *..  **.** ******
        1 CATTTTCCAATGG-TAATTC

#6 score  83.625, 4 g



More information about the Bio-soft mailing list