New gene identification service

Dan Davison dbd at THEORY.BCHS.UH.EDU
Tue Jul 26 17:36:36 EST 1994


      The Baylor College Of Medicine Computational Biology Group
			     Houston, TX
		       announces a new service
			 The BCM Genefinder.

The services are FGENEH, FEXH, HEXON, HSPL, and SSP.

This message details FGENEH; subsequent messages will detail FEXH,
HEXON, HSPL, and SSP.

NOTE: This service is temporarily being provided through the
University of Houston Gene-Server.  Only two jobs will be run at a
time.


				FGENEH
	 Prediction of gene structure in Human DNA sequences

Analysis of uncharacterized human sequences is available by sending the
file containing a sequence name and a sequence (no more than 80
char/line) to

	service at theory.bchs.uh.edu
with the subject line "FGENEH". 

Example: mail -s FGENEH service at theory.bchs.uh.edu < test.seq

where test.seq a file with the sequence.
 
Method description:
**********************
   Algorithm firstly predicts all possible potential internal exons, 
   and potential 5' and 3'-exon for each internal by linear discriminant
   functions combining characteristics describing various contextual
   features of these exons. Then by method of dynamic programming it 
   searches for optimal combination of these exons and construct gene model.
   
Accuracy:
************
Accuracy have been estimated for the set of 212 complete 
   human genes extracted from GenBank
   and compared with the accuracy of Grail-2 Email server for the same
   data set. It must be noted that these sequences are not independent from the
   "Fgeneh" and "Grail-2" training data.

 Test1 contains the nucleotide sequences from -150 bp before the first coding
   region and until +150 bp after the last coding region.
 Test2 contains  nucleotide sequences of whole GenBank entries.

               Test1:     Fgeneh     Grail-2      Test2:   Fgeneh    Grail-2

Exact exons               80%        39%	   	     73%       39%

Exon nucleotides          91%(0.88)  76%(0.74)             90%(0.82) 73%(0.75)


The numbers in () are the correlation coefficients.
		
For exon prediction in partially sequenced genes you can use "fexh"
(5'-, internal and 3'-exon prediction) and "hexon" (internal exon
prediction), see below.

Submitting sequences via email:
*******************************

  For email submission the sequences must have the following format:  

Name of your  sequence
ccatctctgtcttgcaggacaatgccgtcttctgtctcgtggggcatcctcctgctggca
ggcctgtgctgcctggtccctgtctccctggctgaggatccccagggagatgctgcccag
aagacagatacatcccaccatgatcaggatcacccaaccttcaacaagatcacccccaac
ctggctgagttcgccttcagcctataccgccagctggcacaccagtccaacagcaccaat
atcttcttctccccagtgagcatcg...............

   (Restrict the line length to 80 characters or less).

   You have to send the file containing the sequence to: 

   service at theory.bchs.uh.edu

   Subject line must be:
   FGENEH

   Example: mail -s FGENEH service at theory.bchs.uh.edu < test.seq

Fgeneh output:		
****************
   1st line - name of your sequence
   2nd line - length of your sequence
   3d line - number of potential exons
   4th line and next - positions of predicted exons 
   For example:
   HUMALPHA     4556 bp ds-DNA             PRI       15-SEP-1 
   length of sequence -   4556
   number of potential exon:  10
   380 -    516 
   611 -    727
   839 -    954 
  1147 -   1321
  1819 -   1953 
  2053 -   2125
  2254 -   2388
  2470 -   2661 
  2881 -   2997
  3120 -   3562 

Reference:

  1. Solovyev V.V.,Salamov A.A., Lawrence C.B.
   Predicting internal exons by oligonucleotide composition and 
   discriminant analysis of spliceable open reading frames. 
   (Nucl.Acids Res.,1994, in press).
  2. Solovyev V.V., Salamov A.A. , Lawrence C.B.
   The prediction of human exons by oligonucleotide composition and 
   discriminant analysis of spliceable open reading frames.
   in: The Second International conference on Intelligent systems
   for Molecular Biology (eds. Altman R., Brutlag D.,
   Karp R., Latrop R. and Searls D.), AAAI Press, Menlo Park, CA 
   (1994, in press) 
  3. Solovyev,V., Lawrence,C.B.
    Prediction of human gene structure using dynamic programming 
    and oligonucleotide composition. In: Abstracts of the 4th annual
    Keck symposium. Pittsburgh, 47,1993. 

Problems, comments, and suggestions:
   can be mailed to solovyev at cmb.bcm.tmc.edu.
   













More information about the Bio-soft mailing list