New gene identification service
Dan Davison
dbd at THEORY.BCHS.UH.EDU
Tue Jul 26 17:36:36 EST 1994
The Baylor College Of Medicine Computational Biology Group
Houston, TX
announces a new service
The BCM Genefinder.
The services are FGENEH, FEXH, HEXON, HSPL, and SSP.
This message details FGENEH; subsequent messages will detail FEXH,
HEXON, HSPL, and SSP.
NOTE: This service is temporarily being provided through the
University of Houston Gene-Server. Only two jobs will be run at a
time.
FGENEH
Prediction of gene structure in Human DNA sequences
Analysis of uncharacterized human sequences is available by sending the
file containing a sequence name and a sequence (no more than 80
char/line) to
service at theory.bchs.uh.edu
with the subject line "FGENEH".
Example: mail -s FGENEH service at theory.bchs.uh.edu < test.seq
where test.seq a file with the sequence.
Method description:
**********************
Algorithm firstly predicts all possible potential internal exons,
and potential 5' and 3'-exon for each internal by linear discriminant
functions combining characteristics describing various contextual
features of these exons. Then by method of dynamic programming it
searches for optimal combination of these exons and construct gene model.
Accuracy:
************
Accuracy have been estimated for the set of 212 complete
human genes extracted from GenBank
and compared with the accuracy of Grail-2 Email server for the same
data set. It must be noted that these sequences are not independent from the
"Fgeneh" and "Grail-2" training data.
Test1 contains the nucleotide sequences from -150 bp before the first coding
region and until +150 bp after the last coding region.
Test2 contains nucleotide sequences of whole GenBank entries.
Test1: Fgeneh Grail-2 Test2: Fgeneh Grail-2
Exact exons 80% 39% 73% 39%
Exon nucleotides 91%(0.88) 76%(0.74) 90%(0.82) 73%(0.75)
The numbers in () are the correlation coefficients.
For exon prediction in partially sequenced genes you can use "fexh"
(5'-, internal and 3'-exon prediction) and "hexon" (internal exon
prediction), see below.
Submitting sequences via email:
*******************************
For email submission the sequences must have the following format:
Name of your sequence
ccatctctgtcttgcaggacaatgccgtcttctgtctcgtggggcatcctcctgctggca
ggcctgtgctgcctggtccctgtctccctggctgaggatccccagggagatgctgcccag
aagacagatacatcccaccatgatcaggatcacccaaccttcaacaagatcacccccaac
ctggctgagttcgccttcagcctataccgccagctggcacaccagtccaacagcaccaat
atcttcttctccccagtgagcatcg...............
(Restrict the line length to 80 characters or less).
You have to send the file containing the sequence to:
service at theory.bchs.uh.edu
Subject line must be:
FGENEH
Example: mail -s FGENEH service at theory.bchs.uh.edu < test.seq
Fgeneh output:
****************
1st line - name of your sequence
2nd line - length of your sequence
3d line - number of potential exons
4th line and next - positions of predicted exons
For example:
HUMALPHA 4556 bp ds-DNA PRI 15-SEP-1
length of sequence - 4556
number of potential exon: 10
380 - 516
611 - 727
839 - 954
1147 - 1321
1819 - 1953
2053 - 2125
2254 - 2388
2470 - 2661
2881 - 2997
3120 - 3562
Reference:
1. Solovyev V.V.,Salamov A.A., Lawrence C.B.
Predicting internal exons by oligonucleotide composition and
discriminant analysis of spliceable open reading frames.
(Nucl.Acids Res.,1994, in press).
2. Solovyev V.V., Salamov A.A. , Lawrence C.B.
The prediction of human exons by oligonucleotide composition and
discriminant analysis of spliceable open reading frames.
in: The Second International conference on Intelligent systems
for Molecular Biology (eds. Altman R., Brutlag D.,
Karp R., Latrop R. and Searls D.), AAAI Press, Menlo Park, CA
(1994, in press)
3. Solovyev,V., Lawrence,C.B.
Prediction of human gene structure using dynamic programming
and oligonucleotide composition. In: Abstracts of the 4th annual
Keck symposium. Pittsburgh, 47,1993.
Problems, comments, and suggestions:
can be mailed to solovyev at cmb.bcm.tmc.edu.
More information about the Bio-soft
mailing list