ABI output via Staden
James Bonfield
jkb at mrc-lmb.cam.ac.uk
Wed Jun 8 05:06:40 EST 1994
In article <2t40bi$mt6 at hippo.shef.ac.uk> gn1gt at sunc.sheffield.ac.uk (G Turner) writes:
>Does anyone know if the binary output files from an ABI
>sequencer (containing sequence and trace data) can be read
>by the Staden programme in such a way as to display the trace
>in addition to extracting the sequence? If so, how?
The trace files (not the raw image) can be displayed from within the xbap
contig editor. There is also a trace editor, ted, to display and edit the
traces.
Use from within xbap is only possible if the sequence file you've assembled has
a header of the form:
";%6d%6d%6d%-4s%-16s", where
field 1 = total number of bases called
2 = number of bases in the clipped sequence at the 5' end
3 = number of bases in the sequence in this file
4 = type of trace file.
"ALF " - Pharmacia A.L.F.
"ABI " - ABI 373A
"SCF " - SCF
"PLN " - Text only
5 = name of trace file.
(For more information see the file "$STADENROOT/doc/GelReadingFile.format".)
So for example:
$ cat sample.seq
; 485 64 281ABI sample.abi
;<G--TTCGAGCTCGGTACCCGCCCTGAGTTCACAGCCTTGCCTTGGGTT-C
;<ACCAACCACAGGCC
;>-TTGTTGGCCTTCTTGTCCCTGTTCTCAGAGCCAAGAATTCT-CAGCATT
;>CCTGGCTT-A-A-TTAAAATT-CTGGGCAGCATGG-TTCTGCTGCAGGCA
;>CAAGGGGG-CCTGGCTG-CAAGTTG-AAGG-CAGGGTT-T
CCCCGT-GACAGAGTGTCCAGACAGGCCATCTCTGCTGTCCCTGTGTCCC
CACGCTTCGCAGGGGCACGGATGACCTGTTAGTGCCCAACTCCGTAGCCT
CGCCTCAGTTTCCAACCAACGGGCCCTGTCCCCTCCACGGCCCACCCGCC
CCAG-CCTCCCCAGGAGCACATCCCCTTTCACGGCTTCCATCAGCTCCCA
GCTCCTCAGTCCCCAAATCCAGCTCCTTCCAGGTACCTCCTTTTGGGTTT
ATTCCTTAAGCTTAGGAAAGCCAAGGCT-GA
$
Ted will create such a file. For example:
$ ted -ABI sample.abi -output sample.seq
(Perform any editing and then 'output' sequence and 'include header'.)
Note that for disk space efficiency, the parts of the ABI file used by the
Staden assembly programs can be placed in an 'SCF' file. To convert use the
'makeSCF' utility.
Eg:
$ makeSCF -ABI sample.abi -output sample.scf
$ ls -l sample.abi
-rw-r--r-- 1 jkb users 108253 Jun 8 10:55 sample.abi
$ ls -l sample.scf
-rw-r--r-- 1 jkb users 30665 Jun 8 11:01 sample.scf
As can be seen, the space saving is quite signficant. This needs to be peformed
before the creation of the sample.seq file so that the trace filename listed
there is sample.scf and not sample.abi. Then the sample.abi file can be (eg)
archived to tape and removed from the disk.
James
--
James Bonfield (jkb at mrc-lmb.cam.ac.uk) Tel: 0223 402499 Fax: 0223 412282
Medical Research Council - Laboratory of Molecular Biology,
Hills Road, Cambridge, CB2 2QH, England.
More information about the Bio-soft
mailing list