Modifications to the Genefinder service
Dan Davison
dbd at THEORY.BCHS.UH.EDU
Tue Oct 25 10:19:37 EST 1994
The Baylor College Of Medicine Computational Biology Group
Houston, TX
re-announces a new service
The BCM Genefinder.
***************************************************************************
*********** NOTE ADDRESSES AND FORMATS HAVE CHANGED!! *********************
***************************************************************************
The services are FGENEH, FEXH, HEXON, HSPL, SSP, and NNSSP.
This message details FGENEH; subsequent messages will detail FEXH,
HEXON, HSPL, SSP, and NNSSP.
NOTE: This service is temporarily being provided through the
University of Houston Gene-Server. Only two jobs will be run at a
time.
FGENEH - Prediction of gene structure in Human DNA sequences
(Version 2. 10.5.94)
Department of Cell Biology, Baylor College of Medicine
=========================================================================
Analysis of uncharacterized human sequences is available through
the University of Houston Gene-Server by sending the file containing a
sequence (a sequence name is in the first string) to
service at bchs.uh.edu
with the subject line "fgeneh".
Example: mail -s fgeneh service at bchs.uh.edu < test.seq
where test.seq a file with the sequence.
Method description:
**********************
Algorithm firstly predicts all possible potential internal exons,
and potential 5' and 3'-exon for each internal by linear discriminant
functions combining characteristics describing various contextual
features of these exons. Then by method of dynamic programming it
searches for optimal combination of these exons and construct gene model.
Accuracy:
************
The accuracy have been estimated for the set of 193 complete
human gene entries extracted from GenBank.
The accuracy of precise exon recognition is 81% with a
specificity of 79%. The recognition quality computed at the
level of individual nucleotides is 90% for exons sequences (Sp=93%).
For exon prediction in partially sequenced genes you can use "fexh"
(5'-, internal and 3'-exon prediction) and "hexon" (internal exon
prediction) programs from the Gene_Server.
Submitting sequences via email:
*******************************
For email submission the sequences must have the following format:
Name of your sequence
ccatctctgtcttgcaggacaatgccgtcttctgtctcgtggggcatcctcctgctggca
ggcctgtgctgcctggtccctgtctccctggctgaggatccccagggagatgctgcccag
aagacagatacatcccaccatgatcaggatcacccaaccttcaacaagatcacccccaac
ctggctgagttcgccttcagcctataccgccagctggcacaccagtccaacagcaccaat
atcttcttctccccagtgagcatcg...............
(Restrict the line length to 80 characters or less).
You have to send the file containing the sequence to:
service at bchs.uh.edu
Subject line must be:
fgeneh
Example: mail -s fgeneh service at bchs.uh.edu < test.seq
Fgeneh output:
****************
1st line - name of your sequence
2nd line - length of your sequence
3d line - number of potential exons
4th line and next - positions of predicted exons
For example:
HUMALPHA 4556 bp ds-DNA PRI 15-SEP-1
length of sequence - 4556
number of potential exon: 10
380 - 516
611 - 727
839 - 954
1147 - 1321
1819 - 1953
2053 - 2125
2254 - 2388
2470 - 2661
2881 - 2997
3120 - 3562
Reference:
1. Solovyev V.V.,Salamov A.A., Lawrence C.B.
Predicting internal exons by oligonucleotide composition and
discriminant analysis of spliceable open reading frames.
(Nucl.Acids Res.,1994, in press).
2. Solovyev V.V., Salamov A.A. , Lawrence C.B.
The prediction of human exons by oligonucleotide composition and
discriminant analysis of spliceable open reading frames.
in: The Second International conference on Intelligent systems
for Molecular Biology (eds. Altman R., Brutlag D.,
Karp R., Latrop R. and Searls D.), AAAI Press, Menlo Park, CA
(1994, in press)
3. Solovyev,V., Lawrence,C.B.
Prediction of human gene structure using dynamic programming
and oligonucleotide composition. In: Abstracts of the 4th annual
Keck symposium. Pittsburgh, 47,1993.
Problems, comments, and suggestions:
can be mailed to solovyev at cmb.bcm.tmc.edu.
More information about the Bio-soft
mailing list