Modifications to the Genefinder service

Dan Davison dbd at THEORY.BCHS.UH.EDU
Tue Oct 25 10:19:37 EST 1994


      The Baylor College Of Medicine Computational Biology Group
			     Houston, TX
		      re-announces a new service
			 The BCM Genefinder.

***************************************************************************
*********** NOTE ADDRESSES AND FORMATS HAVE CHANGED!! *********************
***************************************************************************

The services are FGENEH, FEXH, HEXON, HSPL, SSP, and NNSSP.

This message details FGENEH; subsequent messages will detail FEXH,
HEXON, HSPL, SSP, and NNSSP.

NOTE: This service is temporarily being provided through the
University of Houston Gene-Server.  Only two jobs will be run at a
time.

	FGENEH - Prediction of gene structure in Human DNA sequences
			(Version 2.  10.5.94)
	Department of Cell Biology, Baylor College of Medicine
=========================================================================
Analysis of uncharacterized human sequences is available through
the University of Houston Gene-Server by sending the file containing a
sequence (a sequence name is in the first string) to
        service at bchs.uh.edu

with the subject line "fgeneh". 

Example: mail -s fgeneh service at bchs.uh.edu < test.seq

where test.seq a file with the sequence.
 
Method description:
**********************
   Algorithm firstly predicts all possible potential internal exons, 
   and potential 5' and 3'-exon for each internal by linear discriminant
   functions combining characteristics describing various contextual
   features of these exons. Then by method of dynamic programming it 
   searches for optimal combination of these exons and construct gene model.
   
Accuracy:
************
   The accuracy have been estimated for the set of 193 complete 
   human gene entries extracted from GenBank.
		
  The accuracy of precise  exon recognition is 81% with a 
  specificity of 79%. The recognition quality computed at the  
  level of individual nucleotides is 90% for exons sequences (Sp=93%).

  For exon prediction in partially sequenced genes you can use "fexh" 
  (5'-, internal and 3'-exon prediction) and "hexon" (internal exon
  prediction) programs from the Gene_Server. 

Submitting sequences via email:
*******************************

  For email submission the sequences must have the following format:  

Name of your  sequence
ccatctctgtcttgcaggacaatgccgtcttctgtctcgtggggcatcctcctgctggca
ggcctgtgctgcctggtccctgtctccctggctgaggatccccagggagatgctgcccag
aagacagatacatcccaccatgatcaggatcacccaaccttcaacaagatcacccccaac
ctggctgagttcgccttcagcctataccgccagctggcacaccagtccaacagcaccaat
atcttcttctccccagtgagcatcg...............

(Restrict the line length to 80 characters or less).



   You have to send the file containing the sequence to: 
   service at bchs.uh.edu
   Subject line must be:
   fgeneh

   Example: mail -s fgeneh service at bchs.uh.edu < test.seq

Fgeneh output:		
****************
   1st line - name of your sequence
   2nd line - length of your sequence
   3d line - number of potential exons
   4th line and next - positions of predicted exons 
   For example:
   HUMALPHA     4556 bp ds-DNA             PRI       15-SEP-1 
   length of sequence -   4556
   number of potential exon:  10
   380 -    516 
   611 -    727
   839 -    954 
  1147 -   1321
  1819 -   1953 
  2053 -   2125
  2254 -   2388
  2470 -   2661 
  2881 -   2997
  3120 -   3562 

Reference:

  1. Solovyev V.V.,Salamov A.A., Lawrence C.B.
   Predicting internal exons by oligonucleotide composition and 
   discriminant analysis of spliceable open reading frames. 
   (Nucl.Acids Res.,1994, in press).
  2. Solovyev V.V., Salamov A.A. , Lawrence C.B.
   The prediction of human exons by oligonucleotide composition and 
   discriminant analysis of spliceable open reading frames.
   in: The Second International conference on Intelligent systems
   for Molecular Biology (eds. Altman R., Brutlag D.,
   Karp R., Latrop R. and Searls D.), AAAI Press, Menlo Park, CA 
   (1994, in press) 
  3. Solovyev,V., Lawrence,C.B.
    Prediction of human gene structure using dynamic programming 
    and oligonucleotide composition. In: Abstracts of the 4th annual
    Keck symposium. Pittsburgh, 47,1993. 

Problems, comments, and suggestions:
   can be mailed to solovyev at cmb.bcm.tmc.edu.










More information about the Bio-soft mailing list