DOS program to process sequence files into GCG format

HUANGY at SLUVCA.SLU.EDU HUANGY at SLUVCA.SLU.EDU
Fri Feb 3 10:20:49 EST 1995


Hi, everyone:
	This post is via cs.utexas.edu mail-to-news gateway. After I sent 
one post with the same content, I didn't see it on the corresponding 
newsgroups for quite a while. Now, I am sending it again. If somehow the old 
one appears, please excuse me for that.
	Today is 02/03/95, Now is 09:24 am CST, USA

Hello, everyone:

        How many times did you ask yourself that you could use your favorite
word processing softwares to edit your sequences and export these sequence
files out to the VAX/VMS system? How many times did you wonder whether you
could use your PC or MAC instead of a work-ladden VAX/VMS system to edit your
sequence? Have you wondered whether you could run a simple program to arrange
your sequence to get a nice format for your word processing softwares?

        Now and here comes the program which you wish that you could have
programmed. Here, I announce that a simple DOS program, EDNA, is available to
the molecular biology research community. This EDNA program is quite like the
reformat program in the GCG package for the OpenVMS/VAX system. However, it
gives more freedom to edit your sequence with your softwares. You can put
your comments anywhere in the file as long as they are enclosed with a pair
of /* */ marks. It also automatically puts a space between any consequent
periods which you put in the comment part. The output file is in the GCG
format.

        Here is an example:
------------------------------------------------------------------------------
        Input file INPUT.TXT

/* This is first comment... */ GGGGAAaaaa 10 cttt
        tctttttttaaaaaaaaaaaattttttttttttttttt
/* This is second comment */
ttttttttaaaaaggcttttaaaggg

        Output file INPUT.SEQ

 This is first comment. . .

 This is second comment 

 THIS.SEQ  Length: 78  February 01, 1995 21:41  Type: N  Check: 7333  ..

         1  GGGGAAaaaa cttttctttt tttaaaaaaa aaaaattttt tttttttttt

        51  tttttttttt aaaaaggctt ttaaaggg
------------------------------------------------------------------------------

        If you are interested, please drop me a line and I will mail you the
uuencoded file with instructions attached.

        Thank you for your interest.

        Mr. Yinrong HUANG
        Thursday February 2, 1995, 07:42pm CST USA

------------------------------------------------------------------------------
|   * * *    Many people don't know how to use computer softwares,    * * *  |
|   * *    let alone know how they are programmed and how they work.    * *  |
|   * * *    This email ONLY represents my own personal viewpoints.   * * *  |
|   * * * *             With Standard Disclaim included             * * * *  |
------------------------------------------------------------------------------





More information about the Bio-soft mailing list