New server for exon-exon junctions prediction

[Victor V. Solovyev]

*************************************************************************
	RNASPL - Prediction of exon-exon junction positions in
		 cDNA sequences
 	Department of Cell Biology, Baylor College of Medicine
=========================================================================
	Analysis of human cDNA sequences is available through 
University of Houston and Weizmann Institute of Science servers: 
with the name of the program in the subject line 
 
Example:
mail -s rnaspl service at theory.bchs.uh.edu < test.seq
mail -s rnaspl services at bioinformatics.weizmann.ac.il < test.seq

where test.seq a file with the sequence.

 And you can run the program by
WWW BCM Human Genome Center and Search launcher Home page
URL:http://kiwi.imgen.bcm.tmc.edu:8088/search-launcher/launcher.html

for accsess to Gene-finder prediction Help files and programs.
->  BCM Gene Finder

Description:
**********************
   Recognition of exon-exon junctions in cDNA may be very useful for 
gene sequencing when starting with a sequence of cDNA clone. In a given 
cDNA sequence we need to select sites for PCR primers that (hopefully) 
lie in adjacent exons. 
   Prediction is performed by linear discriminant function combining 
characteristics describing  tipical sequences around exon-exon junctions.

  The method is described in 
  Solovyev V.V.,Salamov A.A., Lawrence C.B.
   Predicting internal exons by oligonucleotide composition and 
   discriminant analysis of spliceable open reading frames. 
  (Nucl.Acids Res.,1994, 22,24, 5156-5163).

Accuracy:
********************************
We can not predict exon-exon junction position with very high accuracy,
because some information was lost after splicing. We predict positions
marked by '*', where 75% of potential exon-exon junctions are localized. 
Additionally, we mark '-' positions where exon-exon junctions absent with
probability about 90%.
   We recommend to select primer sequences in continuous '-' regions,
that do not cross '*' or ' ' positions.

Submitting sequences via email:
***********************************
  For email submission the sequences must have the following format:  

Nane of your sequence
ccatctctgtcttgcaggacaatgccgtcttctgtctcgtggggcatcctcctgctggca
ggcctgtgctgcctggtccctgtctccctggctgaggatccccagggagatgctgcccag
aagacagatacatcccaccatgatcaggatcacccaaccttcaacaagatcacccccaac
ctggctgagttcgccttcagcctataccgccagctggcacaccagtccaacagcaccaat
atcttcttctccccagtgagcatcg...............

   (Restrict the line length to 80 characters or less).

RNASPL output:		
******************
   1st line - name of your sequence
   2nd line - your sequence
   3d line:
       '*' shows potential exon-exon junction position (Pr > 0.75)
       '-' shows position where exon-exon junction absent (Pr > 0.90)
       'n' is nonanalyzed flanking position  
    ................................
   For example:
   HSACHG7       690 bp    DNA             PRI       18-DEC-1990                        10        20        30        40        50        60
ATGGCGGCGACGGCGAGTGCCGGGGCCGGCGGGATGGACGGGAAGCCCCGTACCTCCCCT
nnnnnnnnnnnnnnnnnnnn--------  ---------*---- ----*----------
        70        80        90       100       110       120
AAGTCCGTCAAGTTCCTGTTTGGGGGCCTGGCCGGGATGGGAGCTACAGTTTTTGTCCAG
----- *----*--------- -- --------*-------  --------------- -
       130       140       150       160       170       180
CCCCTGGACCTGGTGAAGAACCGGATGCAGTTGAGCGGGGAAGGGGCCAAGACTCGAGAG
-----------*-*--- ---- ------ --*----- -----------*------ --
       190       200       210       220       230       240
TACAAAACCAGCTTCCATGCCCTCACCAGTATCCTGAAGGCAGAAGGCCTGAGGGGCATT
------ ---------- ----------------  ------------------------
       250       260       270       280       290       300
TACACTGGGCTGTCGGCTGGCCTGCTGCGTCAGGCCACCTACACCACTACCCGCCTTGGC
----- -- ------------------------------------------------ --

Problems, comments, and suggestion:
   can be mailed to solovyev at cmb.bcm.tmc.edu.