WWW seq alignment site with "jumbling" test of significance?

Gregg B Wells wellsg at mail.med.upenn.edu
Tue Jan 9 22:13:36 EST 1996


Neil Clarke (Neil.Clarke at qmail.bs.jhu.edu) wrote:
: Anyone know of a WWW site that does an alignment between two protein
: sequences with the option of rerunning the alignement using a randomized
: ("jumbled") sequence? as a test of significance? Having just given a
: lecture on sequence analysis during which I extolled the virtues of the
: Web, I was surprised to find that I couldn't find a good old-fashioned
: Needleman-Wunsch type program out there.  Lots of local homology search
: algorithms and dynamic programming algorithms for database searching, but
: no 'optimal' sequence alignment stuff.  Help, please!

_______________________________________________________________________

The Smith-Waterman algorithm can be used at the GenQuest site from Oak
Ridge National Laboratory for searching protein and DNA sequences.  Here
is the email address for more information:

----------------------------------
GENQUEST E-MAIL SERVER USER MANUAL
----------------------------------

GenQuest can be accessed by sending e-mail to: Q at ornl.gov

Messages to GENQUEST begin with a set of keywords which specify the 
options to
be used in the search. Two key words are mandatory: TYPE and SEQ. The 
remainder
are optional or have default settings. GENQUEST is case insensitive.

EXAMPLE of a typical query:

TYPE DNA6
TARGET SwissProt
METHOD SW -g 13
MATRIX PAM120
SCORE 50
ALIGN 20
SEQ
ATCTATCGTCGAGCTGGTGTCTGTGCTAGTCCACAGACAGHCTCGCTATATATGCT
CGTTTTAAAGCTCGTATATATGCTCTCGCTAGTCCGATCGATGCTCGATCGCTAGTA
TCGTATGATTCTTG
END

This example translates the given DNA sequence in 6 frames and searches
SwissProt, using Smith-Waterman with gap penalty of 13, PAM120 matrix, and
showing top 50 matches and top 20 alignments.




Gregg Wells
Department of Pathology
University of Pennsylvania
Philadelphia, Pennsylvania
USA
email:  wells at athens.dental.upenn.edu




More information about the Bio-soft mailing list