CLUSTAL -> MSF convertor

Jun Ishikawa jun at nih.go.jp
Thu Mar 28 21:47:06 EST 1996


Thank you for your comment.

In article <4jdjbm$mn7 at ratatosk.uio.no> rodrigol at biotek.uio.no (Rodrigo Lopez) writes:

> ClustalW can write GCG's MSF format. Please check the following WWW page:

I know that. But I have already aligned 8000 bp x 20 seqs.,
which took me about a week to get the result. So, I would like
to convert it to MSF.

> readseq is another program that can convert multiple sequence alignment files
> from/to a variety of formats including GCG's MSF, clustal and phylip.

I tried to use readseq, but failed:

BEFORE (filename is temp.aln):
  CLUSTAL V multiple sequence alignment

  hpv01           GTTAACTACCATCATTCATTATTCTAGTTACAACAAGAACCTAGGAGTTAT-----ATGC
  hpv02           ATAATGTATAACTATAA-------TCCTT-TATTTAAAAATAGGGTGTGACCGAAAACGG
  hpv03           TCTAACTATAATTATAAATAACAATGCACATAATAAAAAGTAGGGAGTAACCGAAAACGG

AFTER (filename is temp.msf):
   temp.msf  MSF: 29096  Type: N  January 01, 1776  12:00  Check: 7280 ..

   Name: temp.aln         Len: 29096  Check:  7280  Weight:  1.00

  //

       temp.aln  CLUSTALVmu ltiplesequ encealignm enthpvGTTA ACTACCATCA

       temp.aln  TTCATTATTC TAGTTACAAC AAGAACCTAG GAGTTAT--- --ATGChpvA

       temp.aln  TAATGTATAA CTATAA---- ---TCCTT-T ATTTAAAAAT AGGGTGTGAC

       temp.aln  CGAAAACGGh pvTCTAACTA TAATTATAAA TAACAATGCA CATAATAAAA

Readseq, really, can covert Clustal to MSF? 
Or, new version exists? # I used to version 1Feb93.

Regards,

# Sorry for my poor English.
--
 Jun Ishikawa, Ph.D.	National Institute of Health
 (jun at nih.go.jp)	Dept. of Bioactive Molecules
                        Tokyo, JAPAN




More information about the Bio-soft mailing list