FramePlot 2.0

ISHIKAWA Jun jun at nih.go.jp
Mon Feb 16 02:40:26 EST 1998


FramePlot, a web-based protein-coding region prediction tool for 
high GC-content bacteria, is updated to version 2.0, and is
currently in a beta-test. Please check out the following URL:

	http://www.nih.go.jp/~jun/cgi-bin/frameplot.pl

=============================================================
		New features of version 2.0
=============================================================
Clickable Map: 
    You can get nucleotide and amino acid sequence (FASTA
    format) of the ORF you interested by clicking the graph.  
BLAST Gateway: 
    And you can submit the sequence immediately to the NCBI
    BLAST server.  
Step Size: 
    "Window" is moved along the sequence by the set "step size".
    Larger step size makes FramePlot run much faster. But it
    will produce low resolution plot.  
Auto Image Width: 
     "Image width" is adjusted automatically. 
=============================================================

Comments are very much appreciated.
Thank you.

--
ISHIKAWA Jun, Ph.D.            Natl. Inst. of Infectious Diseases
(jun at nih.go.jp)                Dept. of Bioactive Molecules
AUCUCCCACAUCAAAGCUUGGGCU       Tokyo, JAPAN
http://www.nih.go.jp/~jun/research/ 




More information about the Bio-soft mailing list