Sequence Analysis Windows 95?

jun at nih.go.jp jun at nih.go.jp
Tue Jul 7 21:17:58 EST 1998


In article <35774B0E.4D8F4ABA at any.domain.com> invalid.address at any.domain.com writes:

> > Does anybody know if there is a good, cheap/free program (like DNA strider for
> > the Mac) for sequence analysis ie restriction maps, translations etc for
> > Windows 95.
>
> Yes, there's Prophet, a project of the NIH.  You can download it from
> http://www-prophet.bbn.com/

I'm trying to download Prophet5.0 for Windows from
www-prophet.bbn.com. But the server said "User anonymous access
denied". Reason why?

--
ISHIKAWA Jun, Ph.D.            Natl. Inst. of Infectious Diseases
(jun at nih.go.jp)                Dept. of Bioactive Molecules
AUCUCCCACAUCAAAGCUUGGGCU       Tokyo 162-8640, JAPAN
http://www.nih.go.jp/~jun/research/ 





More information about the Bio-soft mailing list