Sequence Analysis Windows 95?

Wayne Bolton wbolton at arcbs.redcross.org.au
Wed Jul 8 00:02:52 EST 1998


jun at nih.go.jp wrote:
> 
> In article <35774B0E.4D8F4ABA at any.domain.com> invalid.address at any.domain.com writes:
> 
> > > Does anybody know if there is a good, cheap/free program (like DNA strider for
> > > the Mac) for sequence analysis ie restriction maps, translations etc for
> > > Windows 95.
> >
> > Yes, there's Prophet, a project of the NIH.  You can download it from
> > http://www-prophet.bbn.com/
> 
> I'm trying to download Prophet5.0 for Windows from
> www-prophet.bbn.com. But the server said "User anonymous access
> denied". Reason why?
> 
> --
> ISHIKAWA Jun, Ph.D.            Natl. Inst. of Infectious Diseases
> (jun at nih.go.jp)                Dept. of Bioactive Molecules
> AUCUCCCACAUCAAAGCUUGGGCU       Tokyo 162-8640, JAPAN
> http://www.nih.go.jp/~jun/research/

I had a similar problem. Apparently there is a restriction on downloads
outside the USA. I was offerred a password to try but it didnt make any
difference so I gave up.

Can anybody tell me how good Prophet is - should I try again.
-- 
Wayne Bolton

Virology Department
Australian Red Cross Blood Service NSW




More information about the Bio-soft mailing list