Sequence Analysis Windows 95?

Christopher Hopkins chopkins at bbn.com
Wed Jul 8 08:41:39 EST 1998


jun at nih.go.jp wrote:

>I'm trying to download Prophet5.0 for Windows from
>www-prophet.bbn.com. But the server said "User anonymous access
>denied". Reason why?

I currently administer the www-prophet.bbn.com website. Due to export control laws
we are unable to distribute Prophet outside the U.S. without first obtaining address
information of the person wishing to download. The FTP site restricts sites based on
the domain name. Also, if DNS fails then the FTP site will deny anonymous access.
We do allow for anonymous access to those sites that are recognized as "within the
U.S." (with some margin of error of course). These are sites like .edu, .gov, .com,
etc. If you have any problems downloading, please send mail to
prophet-help at bbn.com. Thanks.

Regards,

Chris Hopkins

jun at nih.go.jp wrote:

> In article <35774B0E.4D8F4ABA at any.domain.com> invalid.address at any.domain.com writes:
>
> > > Does anybody know if there is a good, cheap/free program (like DNA strider for
> > > the Mac) for sequence analysis ie restriction maps, translations etc for
> > > Windows 95.
> >
> > Yes, there's Prophet, a project of the NIH.  You can download it from
> > http://www-prophet.bbn.com/
>
> I'm trying to download Prophet5.0 for Windows from
> www-prophet.bbn.com. But the server said "User anonymous access
> denied". Reason why?
>
> --
> ISHIKAWA Jun, Ph.D.            Natl. Inst. of Infectious Diseases
> (jun at nih.go.jp)                Dept. of Bioactive Molecules
> AUCUCCCACAUCAAAGCUUGGGCU       Tokyo 162-8640, JAPAN
> http://www.nih.go.jp/~jun/research/







More information about the Bio-soft mailing list