help needed on Consed

gmei at my-deja.com gmei at my-deja.com
Fri Oct 1 14:32:48 EST 1999


Hi:

We have licensed "Consed", "Phred" and "swat/cross_match/Phrap" package
from UW a few month ago and I am having some techincal questions about
"Consed". I am new to "Phrap" and "Consed".

What we would like to do using "consed" is to use it's "edit" function
to edit our sequences.

We have a set of sequences (from DNA seqeuncer, say "seq_1", "seq_2",
"seq_3" ... "seq_N") that we use to run "blastn" against Genbank
database. Based on blastn results, we separate them and get the
"consensus" sequence.

I am trying to loaded all "seq_N"s and the "consensus" sequence into
"consed" and edit the "consensus" sequence. However no matter how I
tried, the "Consed" would generate the error (see attached) saying that
I do not have the chromat_file for the "consensus" sequence which is
true. I have all the chromat_files for "seeq_N"s in "chromat_dir"
though.

Here is what I did:

1. I manually copy all chromat_files to "chromat_dir" for "seq_1",
"seq_2", "seq_3" ... "seq_N"
2. I manually create a "fasta_seq" file in "edit_dir":

>67_VP_H2 CHROMAT_FILE: 67_VP_H2 PHD_FILE: 67_VP_H2.phd.1 TIME: Thu Oct
1 09:32:
36 1999
TGGATGCAGTACGTAAGCTTGGATCCTCTAGAGTCGACCCACGCGTCCGC
CCAGCTACTTGGGA....
>85_VP_N2 CHROMAT_FILE: 85_VP_N2 PHD_FILE: 85_VP_N2.phd.1 TIME: Thu Oct
1 09:31:
36 1999
TGGATGACGTGACGTAGCTATGATCCTCTAGAGCCGACCTGTGGCAAATG
TGGCTACCCTGCCAAGCGCAAGAGAAAGTATAACTGGAGTGCCAAG...
>91_VP_P2 CHROMAT_FILE: 91_VP_P2 PHD_FILE: 91_VP_P2.phd.1 TIME: Thu Oct
1 09:30:
36 1999
ATGGGAAGACATACGTAAGCTTTGATCCTCTAGAGTCGACCCACGCGTCC...


3. I manually run phred to create corresponding "PHD" files in "phd_dir"
4. I manually run phrap to create "ace" file in "edit_dir":
5. I run "consed" and everthing is fine. I can see the "Phrap" generate
"CONSESUS" in the X-Window.

But when I manually add our own "consensus" sequence in the "fasta_seq"
with something like:
>consenses_example TIME: Thu Oct 1 10:30:36 1999
atgggaagacatacgtaagctttgatcctctagagtcgacccacgcgtcc
gctccattctgtatctatcattaatagacagctgacctaatatattttag
tggtttcaaattatataggccgggtgtggtggctcacgcctttaatcc..

and re-run Phrap to create new "ace" file (which seems to run fine),
then when I run "consed", I would get the error (see attched error
message).

So my questions are:

1. Does Consed require all sequences (in the fasta_file) to have
corresponding chromatic file to run?
2. Is it possible to use Consed to display a set of sequences and edit
them even some of the sequences do not have their corresponding "DNA"
trace file? If yes, how?

Thank you very much for your help.


Guang Mei
zlmei at hotmail.com


-----------Consed error message from unix standard
output:-----------------------
no ~/.consedrc file so no user resources will be used--that's ok
no ./.consedrc file so no project-specific resources--that's ok
exception thrown: ace file error detected from source file
parseAceFile.cpp at 1397
Error in file /home/pavonis/consed/standard/edit_dir/fasta_seqs_01.ace
at line 695.  Line:
 DS TIME: Thu Oct 1 10:30:36 1999

"CHROMAT_FILE: not found" on this DS line.  This may be missing because
you didn't use phredPhrap, phd2seqfasta, and phd2qualfasta.  You must
get these programs from bge at u.washington.edu

ace file: /home/pavonis/consed/standard/edit_dir/fasta_seqs_01.ace
ace file error detected from source file parseAceFile.cpp at 1397
Error in file /home/pavonis/consed/standard/edit_dir/fasta_seqs_01.ace
at line 695.  Line:
 DS TIME: Thu Oct 1 10:30:36 1999

"CHROMAT_FILE: not found" on this DS line.  This may be missing because
you didn't use phredPhrap, phd2seqfasta, and phd2qualfasta.  You must
get these programs from bge at u.washington.edu

Version 8.0 (990506)
ace file error detected from source file parseAceFile.cpp at 1397
Error in file /home/pavonis/consed/standard/edit_dir/fasta_seqs_01.ace
at line 695.  Line:
 DS TIME: Thu Oct 1 10:30:36 1999

"CHROMAT_FILE: not found" on this DS line.  This may be missing because
you didn't use phredPhrap, phd2seqfasta, and phd2qualfasta.  You must
get these programs from bge at u.washington.edu

Version 8.0 (990506)
ace file: /home/pavonis/consed/standard/edit_dir/fasta_seqs_01.ace



Sent via Deja.com http://www.deja.com/
Before you buy.




More information about the Bio-soft mailing list