Primers for Mac
Nancy Phillips
phillinj at SLU.EDU
Mon Feb 7 22:50:27 EST 2000
Hi, I am a confirmed Primers fan, and want to take it from a 68030 with a
FPU to a G3/G4. I had an iMac-owning friend take Primers and mount it on
her machine, and she reported "Here is the message I got "expected a
floating point but found something else". It does give you a script of
commands, perhaps it can be written around by someone who knows how?". Can
you advise me on whether this program can be salvaged with a FPU emulator?
The reason I like it is that I want to be able to scrutinize sequence
closely and position primers with relation to DNA features (away from poor
quality seq., away from feature of importance for mutation testing, etc)
and I like the control one gets with semi-manual design. I work with high
GC sequences and have 95% success in primer design. Thanks for any ideas. I
am not a programmer.
Nancy Phillips, M.D. phone:(314)577-8782
Pathology fax:(314)268-5120
St. Louis University Hospital email: phillinj at slu.edu
3635 Vista Ave.
St. Louis, MO, 63110, USA
aacgccaattgctatccccatattctgctaatcccgagcatggac
---
More information about the Bio-soft
mailing list