bioperl blast.pm
Les Ander
citykid at nospam.edu
Mon Aug 6 05:28:02 EST 2001
Hi,
I am having difficulty using the module that is part of bioperl.
I have tried very hard but i can't get it to work. Can some one please
show me how i can get it to work. thanks
here is the code----------------------------------------
#!/usr/bin/perl
#use strict;
use Bio::Tools::Blast::Run::Webblast qw(&blast_remote);
use Bio::Tools::Blast;
use Bio::Seq;
$seq_obj=Bio::Seq->new(-seq=>'atagacaggactacgcgagctag');
%params = (
-seqs => $seq_obj,
-method => 'remote',
-prog => 'blastn',
-database => 'nr',
-version => 2, # BLAST2
-html => 'on',
-descr => 250,
-align => 250,
-expect => 10,
-gap => 'on',
-matrix => 'PAM250',
-email => undef, # don't send report via e-mail
-filter => undef, # use default
-gap_c => undef, # use default
-gap_e => undef, # use default
-word => undef, # use default
-min_len => undef, # use default
);
$blast_obj = Bio::Tools::Blast->new(
-run => \%params,
-parse => 1,
-signif => '1e-10',
-strict => 1,
);
#@out_file_names = &blast_remote($blast_obj, %params);
------------------------------------------------------------
i get the following error message..
perl blast_search_eg.pl
-------------------- EXCEPTION --------------------
MSG: Can't get sequences to be Blasted: No sequence data.
STACK Bio::Tools::Blast::Run::Webblast::blast_remote
/usr/lib/perl5/site_perl/5.6.0/Bio/Tools/Blast/Run/Webblast.pm:567
STACK Bio::Tools::Blast::_run_remote
/usr/lib/perl5/site_perl/5.6.0/Bio/Tools/Blast.pm:1234
STACK Bio::Tools::Blast::run
/usr/lib/perl5/site_perl/5.6.0/Bio/Tools/Blast.pm:1169
STACK Bio::Tools::SeqAnal::_initialize
/usr/lib/perl5/site_perl/5.6.0/Bio/Tools/SeqAnal.pm:279
STACK Bio::Root::Object::new
/usr/lib/perl5/site_perl/5.6.0/Bio/Root/Object.pm:474
STACK toplevel blast_search_eg.pl:31
-------------------------------------------
Compilation exited abnormally with code 255 at Sun Aug 5 18:56:30
More information about the Bio-soft
mailing list