bioperl blast.pm

Les Ander citykid at nospam.edu
Mon Aug 6 05:28:02 EST 2001


Hi,
I am having difficulty using the module that is part of bioperl.

I have tried very hard but i can't get it to work. Can some one please
show me how i can get it to work. thanks

here is the code----------------------------------------
#!/usr/bin/perl
#use strict;

use Bio::Tools::Blast::Run::Webblast qw(&blast_remote);
use Bio::Tools::Blast;
use Bio::Seq;

$seq_obj=Bio::Seq->new(-seq=>'atagacaggactacgcgagctag');


%params = (
	     -seqs     => $seq_obj,
	     -method   => 'remote',
	     -prog     => 'blastn',
	     -database => 'nr',
	     -version  => 2,	# BLAST2
	     -html     => 'on',
	     -descr    => 250,
	     -align    => 250,
	     -expect   => 10,
	     -gap      => 'on',
	     -matrix   => 'PAM250',
	     -email    => undef, # don't send report via e-mail
	     -filter   => undef, # use default
	     -gap_c    => undef, # use default
	     -gap_e    => undef, # use default
	     -word     => undef, # use default
	     -min_len  => undef, # use default
	    );

$blast_obj = Bio::Tools::Blast->new(
 -run     => \%params,
 -parse   => 1,
 -signif  => '1e-10',
  -strict  => 1,
			  );


#@out_file_names = &blast_remote($blast_obj, %params);
------------------------------------------------------------
i get the following error message..


perl blast_search_eg.pl
-------------------- EXCEPTION --------------------
MSG: Can't get sequences to be Blasted: No sequence data.
STACK Bio::Tools::Blast::Run::Webblast::blast_remote
/usr/lib/perl5/site_perl/5.6.0/Bio/Tools/Blast/Run/Webblast.pm:567
STACK Bio::Tools::Blast::_run_remote
/usr/lib/perl5/site_perl/5.6.0/Bio/Tools/Blast.pm:1234
STACK Bio::Tools::Blast::run
/usr/lib/perl5/site_perl/5.6.0/Bio/Tools/Blast.pm:1169
STACK Bio::Tools::SeqAnal::_initialize
/usr/lib/perl5/site_perl/5.6.0/Bio/Tools/SeqAnal.pm:279
STACK Bio::Root::Object::new
/usr/lib/perl5/site_perl/5.6.0/Bio/Root/Object.pm:474
STACK toplevel blast_search_eg.pl:31
-------------------------------------------

Compilation exited abnormally with code 255 at Sun Aug  5 18:56:30







More information about the Bio-soft mailing list