esim4: EMBASSY variant of sim4

David Mathog mathog at caltech.edu
Sat Dec 15 08:50:41 EST 2001


Greetings all.

A version 1.0.0 port to EMBOSS (as an EMBASSY program) of the sim4
program
from

  http://globin.cse.psu.edu/globin/html/docs/sim4.html

is now available.  It seems to work exactly like the original - based on
fairly
limited testing.  The esim4 version works within the W2H interface as
well.

You may download it from:

ftp://saf.bio.caltech.edu/pub/software/molbio/ESIM4_1.0.0.tar.gz 

The only bug I found in it was present in the original as well, where a
fake mRNA
made by deleting several sections of the DMWHITE genbank entry, when
aligned to
DMWHITE, often had a few bases of genomic sequence assigned at the wrong
end of the
intron.  Example

   3000     .    :    .    :    .    :    .    :    .    :
   2983 CTACATTCTTTTTTA ATAAC         AACTATAATAATAAGAATAC
        |||||||||||||||-| || <<<...<<<||||||||||||||||||||
   7985 CTACATTCTTTTTTACAAAAAATA...AACAACTATAATAATAAGAATAC

which should have been

   3000     .    :    .    :    .    :    .    :    .    :
   2983 CTACATTCTTTTTTA         ATAACAACTATAATAATAAGAATAC
        |||||||||||||||<<<...<<<|||||||||||||||||||||||||
   7985 CTACATTCTTTTTTACAA...AAAATAACAACTATAATAATAAGAATAC

Could be that mucking around with the command line settings would
correct this.

Please report any bugs or bug fixes.  The EMBOSS folks may place this
distribution with the other EMBASSY packages.

If somebody feels like adding a display mode 6, to output the full
alignment in a fasta
file format, please be my guest!!

Regards,

David Mathog
mathog at caltech.edu





More information about the Bio-soft mailing list