Newbie with RNA folding troubles

Andres Moreira andres.moreira at terra.cl
Thu Oct 16 08:11:14 EST 2003


I'm rather new to RNA folding calculations. I want to compute the free 
energy of some possible folds of a number of RNA sequences (all of them 
rather short, just 22 bases). Unfortunaterly, RNAdraw and the Vienna 
routines are giving me different results, and neither of them is the one 
that I was expecting. I don't know where the problem lies. My particular 
test case is the following sequence:
   ugccauucaagaugaaugguac
When I used the Vienna package (linked from my own c++ code) at 37 
degrees, it gave me the structure
    ugccauuca aga
    ||||||||
   caugguaagu
When I used RNAdraw, at the same temperature, it gave me
    ugccauuca aga
     ||||||||
   caugguaagu
So, one program excludes an "a-u" base pair at one end of the stack, and 
the other program excludes an "a-u" base pair at the other end. Of 
course, I was expecting both base pairs to be included (and hence, a 9 
bp stack). When I forced the 9 base pairs on RNAdraw, it gave me a very 
high energy (it jumped from approx. -9 Kcal to 800 Kcal).

Since I'm not a biologist (just a mathematician) I don't know if there 
is some biological reason for not using the 9 base pairs. But since this 
programs are using classical algorithms, which assume the energy of a 
base pair to depend only on the immediate neighbours, I don't understand 
neither the discrepancy between the two programs nor the discrepancy of 
both with my expectations. Any hint? Please!

---





More information about the Bio-soft mailing list