Questions about the primer design software usage
Tom Knight
tk at suspiria.ai.mit.edu
Thu Feb 26 13:53:11 EST 2004
wleemd at mail.edu.cn ("Jack Lee ") writes:
> I tried the "Primer3" software (web based edition) to test a pair of
> primers I found on a paper, but always got the output:"specified
> left/right primer not found in the sequence." What's the wrong
> here?
> I searched the web, and found an introduction to "Primer3", it
> mentioned forward and reverse primer, but in papers "forward and
> reverse primer" never occured.
> Some papers only gave:
> "Primer A 5' agttca......ccagtatt 3'
> B 5' ccagta......cagattat 3'"
> Some said:
> "Primer 5' agttca......ccagtatt
> 3' ccagta......cagattat
> So which is the forward primer, which is the reverse primer?
It is only a matter of convention as to which is "forward" and which
is "reverse". Often, if a gene is being made, the "forward" primer
will be at the N-terminus (ATG start) end of the protein coding
region, but this is just convention.
The PCR reaction itself has no specific orientation. The two primers
are oriented such that their 3' ends are closest together and their 5'
ends are furthest apart. Primers match the two opposite strands of
the original DNA sequence. Thus, if you are trying to match the
primers in a paper with the sequence they are amplifying, and the
primers are both listed in 5' to 3' order (as they would be when
ordered), then the "reverse" sequence would need to be
reverse-complemented to match the sequence of the template strand.
For the first example above, e.g., the PCR reaction would look like this:
REV 3'tattagac......atgacc 5'
template 5'agaattcatcgagttcagacagctatcgatgacagtcactgatcgataatctgagagagtactgggactc 3'
3'tcttaagtagctcaagtctctcgatagctactgtcagtgactagctattagactctctcatgaccctgac 5'
FWD 5' agttca.......ccagtatt 3'
with the product 5' agttcagacagctatcgatgacagtcactgatcgataatctgagagagtactgg 3'
3' tcaagtctctcgatagctactgtcagtgactagctattagactctctcatgacc 5'
You second example, in which the second primer is written in 3' to 5'
order would be rare.
Primer3 gives you primers as they would be synthesized as primary
output. It also shows you how they would bind to the template strand,
and there, the regions are shown in 5' to 3' orientation on the
template strand, so the reverse primer is reverse-complemented.
More information about the Bio-soft
mailing list