[Bio-software] transeq
npriya
via bio-soft%40net.bio.net
(by npriyarao from gmail.com)
Tue Mar 27 19:56:59 EST 2007
Hi All,
I have a list of nucleotide sequences (in fasta format) that I want to
translate to protein using frames specified by me. Is there any
software that can do this.
I tried transeq - but it will only do one sequence per file at a time.
Conversely although the program can accept multiple sequences at a
time, it can only translate in one or all frames. I have a few
hundreds to translate with specific reading frames.
eg:
>ABCD frame=+1
ATCTCTCTCTCTCTTCTCTTC
>CDEF frame=-3
ATGTCTCTCTCTCTCTCT
etc...
I tried to write a perl program to do this. I used two arrays (seq and
frame) and using a for loop tried to iterate over the number of
sequences, calling transeq as a system command. It doesn't seem to be
working. It seems like, transeq cannot recognize the fasta sequence by
itself (as opposed to getting it from a file). (I must admit I am
novice at writing perl programs!!!)
Any help will be greatly appreciated.
Thank you,
Priya
More information about the Bio-soft
mailing list