From sanjaysingh765 from gmail.com Sun Apr 5 10:16:50 2009 From: sanjaysingh765 from gmail.com (chunnu) Date: Sun Apr 5 12:21:04 2009 Subject: [Bio-software] intron-exon boundry prediction Message-ID: <429db218-080e-42eb-883a-960a0c062a61@y34g2000prb.googlegroups.com> hi there, i m looking for a eoxn/intron boundry prediction tool.although there are nuber of tools available for this but they didn't produce the grphical outputs means they didn't show the region of exon/introns on input. can anyone help me regardng this. regards sanjay From oscadd from gmail.com Fri Apr 10 11:22:24 2009 From: oscadd from gmail.com (Raghava) Date: Sat Apr 11 12:01:19 2009 Subject: [Bio-software] Prediction of guide strand of microRNAs Message-ID: Dear Colleagues We have developed a method for predicting "guide strand of microRNAs from its sequence and secondary structure" it is published in BMC Bioinformatics see http://www.biomedcentral.com/1471-2105/10/105 . Though it is developed to discriminate for guide and passenger strand of miRNA but it can be used to design siRNA. I hope this information will be useful for bioinformatics community. With Regards Raghava #====================================================== # Dr G P S Raghava FASc, FNASc, Scientist and Head Bioinformatics Centre # # Institute of Microbial Technology, Sector-39A, Chandigarh, India # # Phone: +91-172-2690557, Fax: +91-172-2690632 # # Eadd: http://www.imtech.res.in/raghava/ raghava@imtech.res.in # #=====================================================- From db60 from st-andrews.ac.uk Tue Apr 14 07:01:41 2009 From: db60 from st-andrews.ac.uk (Daniel Barker) Date: Tue Apr 14 09:55:58 2009 Subject: [Bio-software] bms_runner 1.3 Release Message-ID: Dear all, bms_runner is free software to predict functional linkage among gene products, on the basis of correlated gain and loss of genes from genomes . It does this by helping the user to configure and repeatedly launch the separate BayesTraits program . bms_runner version 1.3 has just been released, with improvements over the previous version. bms_runner works on Linux or Mac OS X. It may be downloaded here: http://biology.st-andrews.ac.uk/cegg/downloads.aspx I will be happy to receive any questions and feedback on bms_runner. If you wish to receive an email every time bms_runner is updated, please let me know and I'll add you to my list of users. Best regards, Daniel -- Daniel Barker http://bio.st-andrews.ac.uk/staff/db60.htm The University of St Andrews is a charity registered in Scotland : No SC013532 From lab_jym from prodigy.net.mx Wed Apr 15 23:28:52 2009 From: lab_jym from prodigy.net.mx (=?iso-8859-1?Q?Juan_Enrique_Acu=F1a_K.?=) Date: Thu Apr 16 10:50:23 2009 Subject: [Bio-software] RefVal software Message-ID: <000501c9be4b$d9b54510$8d1fcf30$@net.mx> Dear Professor Solberg, I have read very convincing reports about RevVal and would therefore like to ask, if you knew how this application could be available? Thanks for your help! Sincerely, Qu?m. Juan Enrique Acu?a Kaldman Laboratorio Acu?a y Asociados, S. C. Serd?n 404 Pte. Colonia Centro Guaymas, Sonora 85400 Mexico From raghavagps from gmail.com Mon Apr 20 12:20:57 2009 From: raghavagps from gmail.com (Raghava) Date: Mon Apr 20 12:45:44 2009 Subject: [Bio-software] Potential Vaccine Candidates Message-ID: Dear Colleagues, Recently, we have published MHCBN version 4.0 in BMC research notes. This databases contains T-cell epitopes, potential candidates for subunit vaccine design. Original MHCBN database (Bioinformatics Vol. 19 no. 5 2003) is heavily used by scientific community; cited more than 100 times in last five years. You may access new version from following sites http://www.biomedcentral.com/1756-0500/2/61/abstract I hope this information will be usefull for your research With Regards Raghava ====================================================== # Dr G P S Raghava, Scientist and Head Bioinformatics Centre # # Institute of Microbial Technology, Sector-39A, Chandigarh, India # # Phone: +91-172-2690557, Fax: +91-172-2690632 # # Eadd: http://www.imtech.res.in/raghava/ raghava@imtech.res.in # #===================================================== From jlynn from acsalaska.net Wed Apr 22 03:03:49 2009 From: jlynn from acsalaska.net (jlynn@acsalaska.net) Date: Wed Apr 22 07:48:40 2009 Subject: [Bio-software] comp linguistics - pseudoknots Message-ID: My approach to finding RNA sructure, including pknots and triple helix is a bit different: I strictly search for structure ingnoring specific nt sequence by writing formal grammars for what ever I'm looking for. Simple examples are find a sequence that matches loops ((((::::)))), pknots ((((::::[[[:::))))::)))) or even something like a triple helix pknot: mt plasmid DNA (((::[[[:::{{{:::))):::]]]:::}}} ATCAGAAAGCGTGGTCTGATGTTTTTTCACCA platipus genome (((::[[[::{{{:::))):::]]]:::}}} CAAGTTCTATTGAGTTTTGGGGAGAAGGTCA platipus genome (((:::[[[:::{{{:::))):::]]]:::}}} CACAGCTGATGATAAATGGTGGAGTCAGGATTA Its obvious we get many "impossible" or ambiguous structures as matches but as the complexity of the structure increases the probability that the matched structure is something "real" increases. Its essentially a way around the NP problem and for most H-type pknots I can scan a complete viral genome in about 1-3 minutes - all grammars seem to parse in O(n) time. I like some feedback on the worth of such a method. James Lynn www.rnaparse.com From Rob.Reedijk from douglasconnect.com Wed Apr 22 10:25:56 2009 From: Rob.Reedijk from douglasconnect.com (Robby) Date: Wed Apr 22 10:55:31 2009 Subject: [Bio-software] Predictive ADMET Workshop: Application of Predictive ADME and Toxicology methods to drug discovery and development, Oxford July 27-31, 2009 Message-ID: I am posting information on a 5 day workshop taking place at Oxford University in July 2009. 27-31 July, 2009 Predictive ADMET Workshop: Application of Predictive ADME and Toxicology methods to drug discovery and development, a Hands-on 5 Day eCheminfo Workshop. Case Study Approach on ADME and Tox endpoints and datasets. http://echeminfo.com/comty_oxfordadmet09 Medical Sciences Teaching Centre, Oxford University, Oxford, UK Bursarys award available (deadline February 20, 2009) facilitated by Barry Hardy eCheminfo Community of Practice These workshops are aimed to provide a set of stimulating workshops using latest advanced in silico techniques of relevance to chemists, life scientists, clinical researchers, toxicologists and modellers working in drug discovery and development. Participants should return to their labs with new ideas, best practices and software experiences to maximise productivity in their own drug discovery and development research activities. Workshop groups will study problems with hands-on examples using leading-edge software and discuss complex issues highlighted by examples and case studies presented by instructors. A case study set will be used to link all workshop activities through the week. Workshop Instructors Barry Hardy (Douglas Connect), Ismael Zamora (Pompeu Fabra University and Lead Molecular Design), Christoph Helma (in silico toxicology), David Leahy (University of Newcastle), Philip Judson (Lhasa), Anton Hopfinger (University of New Mexico), Mark Cronin (Liverpool John Moores University), Olga Obrezanova (BioFocus DPI), Glen Myatt (Leadscope), Judith Madden (Liverpool John Moores University), Arianna Bassan (S-IN) Software packages and an IT classroom will be used by instructors and participants to work through Predictive ADME and Toxicology problems. Participants may propose problems and issues to the faculty ahead of the workshop. Participants will also have ample opportunity to discuss their perspectives and criticisms of the methods studied and should take-away key nuggets of understanding from these intensive sessions. A related workshop will run the week before 20-24 July, 2009 Drug Discovery Design Methods & Applications: Virtual screening, structure-based drug design, cheminformatics and molecular modelling supporting drug discovery and design, a Hands-on 5 Day eCheminfo Workshop. Case Study approach including Kinases. http://echeminfo.com/comty_oxfordworkshop09 For further information and questions on the Workshop programs, please contact Dr. Barry Hardy at: barry.hardy -[at]- douglasconnect.com, Tel: +41 61 851 0170 For registrations, please contact Nicki Douglas, nicki.douglas -[at]- douglasconnect.com, Tel: +41 61 851 0461 From zchou from wayne.edu Wed Apr 22 11:55:21 2009 From: zchou from wayne.edu (zhuocheng Hou) Date: Wed Apr 22 11:59:02 2009 Subject: [Bio-software] short-reads assemble and mapping Message-ID: <8930b34e0904220955i2529f23bjbb64fa33a556188b@mail.gmail.com> Hi Everyone, I am seeking for software which can assembl short-reads (<60bp) and also can use draft genomic data to pileup data. As I know, MAQ, Velvet, ELAND etc didn't use draft genome data. I guess we can get the better assembl results by incoporating the short-reads and genomic data. Can anyone give me some clues about these kinds of software? Thanks, Zhuocheng From lry198010 from gmail.com Tue Apr 28 06:16:09 2009 From: lry198010 from gmail.com (lry198010) Date: Tue Apr 28 09:51:24 2009 Subject: [Bio-software] Re: short-reads assemble and mapping References: Message-ID: <552dcab7-0b1d-42f8-9114-7abab5cfe978@w35g2000prg.googlegroups.com> On Apr 23, 12:55?am, zhuocheng Hou wrote: > Hi Everyone, > > I am seeking for software which can assembl short-reads (<60bp) and also can > use draft genomic data to pileup data. As I know, MAQ, Velvet, ELAND etc > didn't use draft genome data. I guess we can get the better assembl results > by incoporating the short-reads and genomic data. Can anyone give me some > clues about these kinds of software? > > Thanks, > Zhuocheng Hi: I have remember that bioinformatics or BMC bioinformatics have publish a paper recently, which introduce a new assembly tool agree with the requirement. From paolo.romano from istge.it Tue Apr 28 08:29:47 2009 From: paolo.romano from istge.it (Paolo Romano) Date: Tue Apr 28 10:21:49 2009 Subject: [Bio-software] NETTAB 2009: Deadline postponed to May 4, 2009, for Oral communications Message-ID: <200904281343.n3SDhw5P036512@ibm43p.biotech.ist.unige.it> Due to many requests for a new deadline for submission of contributions for oral communications, the related deadline has been postponed to: Monday May 4, 2009, at 12.00 (noon), EST (GMT+1). ===== Last Call for Oral communications NETTAB 2009 Workshop on "Technologies, Tools and Applications for Collaborative and Social Bioinformatics Research and Development" with a Special Session on: "Methods and Tools for RNA Structure and Functional Analysis" June 10-13, 2009 Department of Computer Science, University of Catania, Italy http://www.nettab.org/2009/ Deadline approaching: May 4, 2009: Oral communication submission Contributions must be short papers of around THREE A4 pages or 12.000 characters long. Submit through the EasyChair system at: http://www.easychair.org/conferences/?conf=nettab2009 . See web site for details. Motivation The most recent developments of collaborative development tools are impressive. Researchers can now collaboratively develop software (open source systems), discuss and compare development strategies (social networks), write documents (google docs, wiki systems), build knowledge bases. So, it may now be the time for presenting current technologies, tools and applications for collaborative work and for discussing perspectives of their utilization in support of Bioinformatics. For these reasons, NETTAB 2009 will be devoted to "Technologies, Tools and Applications for Collaborative and Social Bioinformatics Research and Development". The RNA community is also taking advantage of collaborative research tools such as Wikis and other virtual environments. The RNA WikiProject contains now over 600 articles describing families of noncoding RNAs based on the Rfam database, and invite the community to update, edit, and correct those articles. Therefore, the NETTAB 2009 special session will focus on collaborative research project, computational methods and tools for the analysis of RNA structures and functions, with a special emphasis on ncRNAs. Invited Speakers (more to be announced) # Alex Bateman Wellcome Trust Sanger Institute, Hinxton, Cambridge, UK # Doron Betel MSKCC - Computational Biology Center New York, USA # Tim Clark Director of Informatics, MassGeneral Institute for Neurodegenerative Disease Neurology Research Department, Massachusetts General Hospital, Boston, USA # Duncan Hull School of Chemistry, University of Manchester, Manchester, UK # Gabriel Valiente Technical University of Catalonia, Department of Software, Barcelona, Spain # Debora Marks Systems Biology Department, Harvard Medical School, Boston, USA # Gabriel Valiente Technical University of Catalonia, Department of Software, Barcelona, Spain Topics - Collaborative Web sites (bioinformatics.org, biojava, bioperl, ) - Communities of Practices (CoPs) Scientific practices in scientific communities Automatic detection / gathering / modelling of scientific practices Implementations of CoPs - Social networking (myExperiment, Annotea, myScience) Social Bookmarking Semantic Document Markup Relationships mining from literature - Open Source development Sharing of data models, libraries, interfaces - Social software for collaborative documentation development Wikis, blogs, google docs Knowledge Wikis Social-software-mediated collaborative scientific research Social-software-mediated collaborative tools' development Knowledge base collaborative development Ontologies collaborative development - Education and training tools E-learning Virtual environments Methods and Tools for RNA Structure and Functional Analysis - RNA structure prediction - Collaborative studies of RNAs - ncRNAs functional analysis and classification - miRNAs and networks - Genome-wide functional studies - Identification of ncRNAs - Databases of ncRNAs and miRNA targets - miRNA targets prediction - Synthetic miRNA and siRNA design - Gene expression analysis - Analysis of viral RNAs - RNAi therapeutics - Identification of ncRNAs biomarkers - RNA-protein interaction prediction Deadlines Contributions for both oral communications and posters must be short papers of around THREE A4 pages or 12.000 characters long. They must be submitted through the EasyChair system at: http://www.easychair.org/conferences/?conf=nettab2009 . - May 4, 2009: Oral communication submission - May 15, 2009: Posters submission - May 17, 2009: Early registration - June 10-13, 2009: Tutorials and Workshop Calls for SPECIAL ISSUES We plan to launch Calls for Special Issues on the themes of the workshop in peer-review journals with associated Impact factor around July for submission in September 2009. Best regards. Paolo Romano on behalf of NETTAB 2009 Chairs NETTAB '09 - Ninth International Workshop on Network Tools and Applications in Biology 10-13 June 2009, Catania, Italy http://www.nettab.org/2009/ Paolo Romano (paolo.romano@istge.it) Bioinformatics National Cancer Research Institute (IST) From gilbertd from kalo.bio.indiana.edu Tue Apr 28 13:43:49 2009 From: gilbertd from kalo.bio.indiana.edu (Don Gilbert) Date: Tue Apr 28 14:14:33 2009 Subject: [Bio-software] Re: short-reads assemble and mapping References: Message-ID: You might also look at this web forum, SEQanswers, http://seqanswers.com/ "SEQanswers was founded to be an information resource and user-driven community focused on all aspects of next-generation genomics" e.g. bioinformatics aspects are at http://seqanswers.com/forums/forumdisplay.php?f=18 - Don Gilbert -- -- d.gilbert--bioinformatics--indiana-u--bloomington-in-47405 -- gilbertd@indiana.edu--http://marmot.bio.indiana.edu/