TAC Repeat

[Tony Meyn]

I recently sequenced a fungal gene that contained the sequence:

AATATTACTACTACTACTACTACTACT

within a transcribed but untranslated region.

A database search revealed a number of eucaryotes with this "TAC" repeat,
but investigation of the papers did not reveal anything of use about
this sequence.  Any help leading to info. about this sequence would be
appreciated.  

Tony Meyn
University of Arizona