green smear/auto. sequencing
Vahe Bedian
dnasequence at MSCF.MED.UPENN.EDU
Fri Mar 3 11:08:42 EST 1995
Hello,
We have recently and suddenly run into the notorious green smear problem.
It is intense on one side of the scan, and it switches sides when we pour
the gel at the opposite corner of the plate assembly. This behaviour
obviously suggested a residue on the plates that dissolves in the
acrylamide/urea gel mix on the side we pour, and accumulates on the
opposite side. We have not changed our detergent (dissolved alconox), and
are very careful about rinsing the detergent off, but I would not rule that
out as a possibe cause. I understand from ABI tech support that other labs
have encountered the same problem, but possibly for different reasons. We
would appreciate any advice you may have. Thanks,
Vahe Bedian
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT
University of Pennsylvania Department of Genetics
DNA Sequencing Facility
455 Clinical Research Building, 422 Curie Blvd, Philadelphia, PA 19104-6145
Vahe Bedian, Ph.D. Technical Director Phone: 215-573-7407
Sabine Baxter, Research Specialist Fax: 215-573-5892
Tasha Adams, Research Specialist e-mail: DNASequence at mail.med.upenn.edu
Charlotte Furey, Research Specialist FTP: DNASEQ.MED.UPENN.EDU
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT
More information about the Biochrom
mailing list