green smear/auto. sequencing

Vahe Bedian dnasequence at MSCF.MED.UPENN.EDU
Fri Mar 3 11:08:42 EST 1995


Hello,

We have recently and suddenly run into the notorious green smear problem.
It is intense on one side of the scan, and it switches sides when we pour
the gel at the opposite corner of the plate assembly. This behaviour
obviously suggested a residue on the plates that dissolves in the
acrylamide/urea gel mix on the side we pour, and accumulates on the
opposite side. We have not changed our detergent (dissolved alconox), and
are very careful about rinsing the detergent off, but I would not rule that
out as a possibe cause. I understand from ABI tech support that other labs
have encountered the same problem, but possibly for different reasons. We
would appreciate any advice you may have. Thanks,

Vahe Bedian


ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT

            University of Pennsylvania    Department of Genetics

                            DNA Sequencing Facility

 455 Clinical Research Building, 422 Curie Blvd, Philadelphia, PA 19104-6145

Vahe Bedian, Ph.D. Technical Director                      Phone: 215-573-7407
Sabine Baxter, Research Specialist                           Fax: 215-573-5892
Tasha Adams, Research Specialist        e-mail: DNASequence at mail.med.upenn.edu
Charlotte Furey, Research Specialist                 FTP: DNASEQ.MED.UPENN.EDU

ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT





More information about the Biochrom mailing list