Hello again.
A while ago I posted a question relating to whether it is possible
for a cell to 'recognise' (no teleology or imputation of purpose
implied...) if it contains too many copies of a particular
chromosome, and whether any mechanism exists for a cell to get rid
of supernumary chromosomes. Vahe Bedian has suggested that studies
of interspecific cell hybrids might demonstrate if there are
factors leading to the preferential loss of particular chromosomes.
Is anyone aware of any work in this area?
One aspect of the problem that I have thought about is that it is
in the chromosome's 'interest' (selfish gene wise) to be in a
euploid cell, and not to get chucked out. Thus a mechanism for
ensuring this may have a selective advantage, although what that
mechanism could entail is an interesting problem.
Any thoughts?
Shane
Shane McKee (JHO, RVH, Belfast) | / Art becomes science when
Shane at reservoir.win-uk.net --O-- you start trying to figure
AGACTGCGCTTGCTTTACACATTTCTTCTC / | out what the heck you're doing
