genes

Guy gslater at hgmp.mrc.ac.uk
Mon Dec 8 08:45:11 EST 1997


Super Ninja wrote:
> 
> I heard that there's a lot of our DNA that we don't know it's purpose.
> and since long term memory is stored protien, that this "useless" DNA
> could possibly be memory that has beened passed on from older
> generations.  For instance, the long term memory that our oldest
> ancestors stored during their lifetime, may now be stored in our DNA.
> Could this really happen?

Dear Super Ninja,

Yes - now it all makes sense:

The comparatively high gene density observed in some fish 
and their correspondingly low quota of junk DNA would account 
for their inability to remember very much.

Guy.
--

PS. Here is some freshly sequenced junk human DNA ready for analysis

>junk.seq
GCGAACTGTATAGAAAATACGTAAGAGGGATATCCGACAATAGCAAACAGCTAGCCACGA
GAATGCGAAGAGGATGAAGACTGAACACACGAGTAAGGCCGCGAGGAAAAATGATGTATC
GTAATATTAATAAGCGCGACCATTCAGAACTGAACACATGAGAACTGAACGCACGAATAA
AGACAAATGGCCAACTGAGAAATGCCAATACGTGAGTGAGCGAACGATTAAACCCATGAA
TAATTAATCTTCGAGTGACAGTTCTGATGTCACAGAATAAGCACATAGCTAGCCACCGAA
AGATGACAAAATTAGACACACGAAAGAGAATGATGGGCCAGCTAAACACACGCCACGTGA
GACGAATTTGAAGCGACGTAAGCGACATAGCACGCCTCGACCATAAATGGCAGCTGAAAC
GAAGTAGAAAGAACGCACGAATTGGAAAGCAGCTAAGAAAACGGCTTGGCCAATGACTAA
TGGCAAAACTAAACCCACGAATGATGGCAGAGGTTGGACTAGTGCGTACCATAAATAAAC
TGAAACATAAACGAGACTGAGGAAAACTAAAGCATANNNACCTATTAGAGCATANNN



More information about the Biochrom mailing list