FMAP - Super-fast search of query sequence over human genome

webmaster_softberry_com at acedsl.com webmaster_softberry_com at acedsl.com
Wed Dec 12 18:01:44 EST 2001


 FMAP - Super-fast search of query sequence over human genome

It takes FMAP less than a second to map a sequence on a genome. 
Splice site recognition feature allows FMAP 
http://www.softberry.com/showmap.html
to accurately map multi-exon ESTs and mRNAs. 
It aligns splice sites on Go to our human genome mapping page to try the 
program on human 
genome draft. Alternatively, you can map a sequence in 
Softberry Genome Explorer http://www.softberry.com/genomb/chrvis.htmland 
immediately see a lot of information about mapped site - known and predicted 
genes, 
ESTs, predicted promoters and other.

FMAP - Program for fast alignment of your sequence to Genome sequence 

Web version of FMAP program is running with strong parameters, its local 
execution requires < 1 sec for finding alignments of your sequence with Human 
genome 
about 3 GB. Version with very accurate alignment and more sensitive search - 
RUN Fmap+Scan2. 
To map your RNA or EST sequence USE Fmap+EST_MAP combination which will take 
into account 
splice sites characteristics to select optimal alignment. Program has several 
ouput 
formats one of which is presented in WEB results. 
--------------------------------------------------------------------------------

FMAP output: 


p  Wed Jul 18 23:24:14 EDT 2001
[DD] Sequence:       1, S:         600, L:5805  C9001122 in chr1
Summ of block lengths: 135, Alignment bounds:
On first  sequence: start 104888252, end 104888386, length 135
On second sequence: start      4226, end      4360, length 135
Block of alignment: 1        
    1 P: 104888252    4226 L:     135, G:  81.481, W:    600, S:600
         1        11 104888238 104888248 104888258 104888268
         aattctttgattgat(..)ggccctgctgcaggcTGACCACTTCAGTGGATGCTGTGGTT
         ---------------(..)cagaggtggctctgaTGACCACATCAGTGGATGTCCTTGTG
      4211      4211      4212      4222      4232      4242

 104888278 104888288 104888298 104888308 104888318 104888328
         GCCATCTGCGTGATTTTCTCCATGTCCTTCGTCCCAGCCAGCTTTGTCCTTTATTTGATC
         TCCATCTGTGTCATCTTTGCAATGTCCTTCGTCCCAGCCAGCTTTGTCGTATTCCTGATC
      4252      4262      4272      4282      4292      4302

 104888338 104888348 104888358 104888368 104888378 104888388
         CAGGAGCGGGTGAACAAATCCAAGCACCTCCAGTTTATCAGTGGAGTGAgccccaccacc
         CAGGAGCGGGTCAGCAAAGCAAAACACCTGCAGTTCATCAGTGGAGTGAagcctgtcatc
      4312      4322      4332      4342      4352      4362

 104888398 276020454 276020464
         tact(..)aaccagatctcatga
         tact(..)---------------
      4372      5806      5806
[DR] Sequence:       2, S:        2490, L:5805  C9001122 in chr9
Summ of block lengths: 5777, Alignment bounds:
On first  sequence: start 106389262, end 106448770, length 59509
On second sequence: start         1, end      5805, length 5805
Block of alignment: 40       
    1 P: 106389262       1 L:     138, G: 100.000, W:   1380, S:1380
    2 P: 106390340     139 L:     249, G: 100.000, W:   2490, S:2490
    3 P: 106391247     388 L:      91, G: 100.000, W:    910, S:910
    4 P: 106391820     479 L:     103, G: 100.000, W:   1030, S:1030
    5 P: 106392866     582 L:     134, G: 100.000, W:   1340, S:1340
    6 P: 106393371     716 L:     146, G: 100.000, W:   1460, S:1460
    7 P: 106395871     862 L:     107, G: 100.000, W:   1070, S:1070
    8 P: 106396885     969 L:      61, G: 100.000, W:    610, S:610
    9 P: 106397733    1030 L:     121, G: 100.000, W:   1210, S:1210
   10 P: 106398118    1151 L:     131, G: 100.000, W:   1310, S:1310
   11 P: 106399335    1282 L:     123, G: 100.000, W:   1230, S:1230
   12 P: 106401622    1405 L:     178, G: 100.000, W:   1780, S:1780
   13 P: 106403020    1583 L:     172, G: 100.000, W:   1720, S:1720
   14 P: 106403713    1755 L:      72, G: 100.000, W:    720, S:720
   15 P: 106405254    1827 L:     112, G: 100.000, W:   1120, S:1120
   16 P: 106407827    1967 L:      95, G: 100.000, W:    950, S:950
   17 P: 106409442    2062 L:     190, G: 100.000, W:   1900, S:1900
   18 P: 106412667    2252 L:      99, G: 100.000, W:    990, S:990
   19 P: 106414001    2351 L:     125, G: 100.000, W:   1250, S:1250
   20 P: 106415775    2476 L:     152, G: 100.000, W:   1520, S:1520
   21 P: 106417322    2628 L:     115, G: 100.000, W:   1150, S:1150
   22 P: 106417632    2743 L:      45, G: 100.000, W:    450, S:450
   23 P: 106419344    2788 L:     204, G: 100.000, W:   2040, S:2040
   24 P: 106420534    2992 L:      71, G: 100.000, W:    710, S:710
   25 P: 106421863    3063 L:     224, G: 100.000, W:   2240, S:2240
   26 P: 106422789    3287 L:     133, G: 100.000, W:   1330, S:1330
   27 P: 106423125    3420 L:     146, G: 100.000, W:   1460, S:1460
   28 P: 106424576    3566 L:     130, G: 100.000, W:   1300, S:1300
   29 P: 106425695    3696 L:     174, G: 100.000, W:   1740, S:1740
   30 P: 106427666    3870 L:     113, G: 100.000, W:   1130, S:1130
   31 P: 106428883    3983 L:     206, G: 100.000, W:   2060, S:2060
   32 P: 106430149    4189 L:     224, G: 100.000, W:   2240, S:2240
   33 P: 106432119    4413 L:     221, G: 100.000, W:   2210, S:2210
   34 P: 106434126    4634 L:     174, G: 100.000, W:   1740, S:1740
   35 P: 106434820    4808 L:     211, G: 100.000, W:   2110, S:2110
   36 P: 106435777    5019 L:     197, G: 100.000, W:   1970, S:1970
   37 P: 106440182    5216 L:     114, G: 100.000, W:   1140, S:1140
   38 P: 106440627    5330 L:     142, G: 100.000, W:   1420, S:1420
   39 P: 106443480    5472 L:     243, G: 100.000, W:   2430, S:2430
   40 P: 106448680    5715 L:      91, G: 100.000, W:    910, S:910
         1        11 106389248 106389258 106389268 106389278
         gaattcctggtggag(..)tatgaacaggattctTCATACATAGCTTTCTTTCACTTTCT
         ---------------(..)---------------TCATACATAGCTTTCTTTCACTTTCT
         1         1         1         1         7        17

 106389288 106389298 106389308 106389318 106389328 106389338
         CATCCTGTAGAAAAGATGTGAGAACTGCAACGTCCACTACTGTCTGGTTTTTGTGTAATG
         CATCCTGTAGAAAAGATGTGAGAACTGCAACGTCCACTACTGTCTGGTTTTTGTGTAATG
        27        37        47        57        67        77

 106389348 106389358 106389368 106389378 106389388 106389398
         AGAGGTCTTTTAAGTGGTCATCATCACTTTGGTCCTTGGCAAAGTTCACAAAtacctgtt
         AGAGGTCTTTTAAGTGGTCATCATCACTTTGGTCCTTGGCAAAGTTCACAAA--------
        87        97       107       117       127       137

 106389408 106390325 106390334 106390344 106390354 106390364
         aaaagat(..)ttgacactcaaagctTACTTGGTCAAGTGTTGTCTGAGAAACAGAGTAG
         -------(..)---------------TACTTGGTCAAGTGTTGTCTGAGAAACAGAGTAG
       139       139       139       143       153       163

 106390374 106390384 106390394 106390404 106390414 106390424
         TCTTCTATGTGGAGTCGCTTTTTGCTCTGGGAGAGGATGCTGAATATCCTGGCCAGAGAA
         TCTTCTATGTGGAGTCGCTTTTTGCTCTGGGAGAGGATGCTGAATATCCTGGCCAGAGAA
       173       183       193       203       213       223

 106390434 106390444 106390454 106390464 106390474 106390484
         GATAATGAAGATGGAAGCTGGTATTGTAGCATGTTCCGGTGTTTCTCTTTTAGAACACTT
         GATAATGAAGATGGAAGCTGGTATTGTAGCATGTTCCGGTGTTTCTCTTTTAGAACACTT
       233       243       253       263       273       283

 106390494 106390504 106390514 106390524 106390534 106390544
         CCAGGAAATGCAAGTCCAAAGAAATCCTGGACAGGCTTCAGGTCCGGGTTGGACCCTGCT
         CCAGGAAATGCAAGTCCAAAGAAATCCTGGACAGGCTTCAGGTCCGGGTTGGACCCTGCT
       293       303       313       323       333       343

 106390554 106390564 106390574 106390584 106390594 106391232
         ATTCGTACAACTATTGTATAACCATCTCCAAACCTgaaagcaggaaaaaa(..)ttatct
         ATTCGTACAACTATTGTATAACCATCTCCAAACCT---------------(..)------
       353       363       373       383       388       388

 106391238 106391248 106391258 106391268 106391278 106391288
         ttattacctATTTTTTAGATGCTGGACACTGCCAAGGCACCTGAACCTTCCATTGACCAT
         ---------ATTTTTTAGATGCTGGACACTGCCAAGGCACCTGAACCTTCCATTGACCAT
       388       389       399       409       419       429

 106391298 106391308 106391318 106391328 106391338 106391348
         GATTGCCATCCTAGTGCAAAGAGCTTCACATTCTTCCATActgcggtaaaacaga(..)g
         GATTGCCATCCTAGTGCAAAGAGCTTCACATTCTTCCATA---------------(..)-
       439       449       459       469       479       479

-------------------------------------------------
This mail sent through AceDSL WebMail (http://webmail.acedsl.com)

---




More information about the Biochrom mailing list