restriction enzyme sites in mammalian cell

Eric E. Snyder eesnyder at boulder.Colorado.EDU
Sat Feb 23 15:43:13 EST 1991


BIOCOL at UNIPAD.UNIPD.IT writes:


>In BioNews Thomas Collet says:

>>Does anyone have a compilation of the cutting
>>frequencies of restriction enzymes in immunoglobulin genes (or
>>maybe just mammalian genes in general ?) Or maybe a literature
>>reference ?
>>Thanks

>I think you can try by yourself using stochastic computer methods (as I did),
>for example RND in BASIC. The frequence of cutting for each enzyme must be
>1/4 exp n for each class with n bases of recogniction.

A better way to estimate the cutting frequency is to adjust for genomic
nucleotide composition.  For instance, in AT rich genomes, restriction 
enzymes that have AT rich recognition sequences will cut more frequently
that estimated by (.25)^n, where n is the length of the recognition sequence.

For example,

A = .30
T = .30
C = .20
G = .20

GAATTC = (.2)(.3)(.3)(.3)(.3)(.2) = 3.24x10^-4

vs.

A = C = G = T = .25

GAATTC = .25^6 = 2.44x10^-4

---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder                            
Department of MCD Biology            We are not suspicious enough 
University of Colorado, Boulder      of words, and calamity strikes.
Boulder, Colorado 80309-0347
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------



More information about the Bioforum mailing list