Software for automated subseqence extraction

POSTMAST at gunbrf.bitnet POSTMAST at gunbrf.bitnet
Wed May 1 11:20:00 EST 1991


From:   edu%"eesnyder at boulder.colorado.edu" 29-APR-1991 11:18:10.80
To:     genbank-bb at colorado.edu
CC:
Subj:   Software for automated subseqence extraction

Received: From STANFORD(MAILER) by NBRF with Jnet id 6419
          for POSTMASTER at GUNBRF; Mon, 29 Apr 91 11:18 EDT
Received: by Forsythe.Stanford.EDU; Sun, 28 Apr 91 18:30:08 PDT
Received: by genbank.bio.net (5.61/IG-2.0)
        id AA18837; Sat, 27 Apr 91 12:45:20 -0700
Received: by genbank.bio.net (5.61/IG-2.0)
        id AA18789; Sat, 27 Apr 91 12:44:37 -0700
Message-Id: <9104271944.AA18789 at genbank.bio.net>
To: genbank-bb at colorado.edu
From: eesnyder at boulder.colorado.edu (Eric E. Snyder)
Subject: Software for automated subseqence extraction
Date: 27 Apr 91 18:29:32 GMT
Sender: news at colorado.edu (The Daily Planet)
Nntp-Posting-Host: beagle.colorado.edu

I am looking for some software that will allow me to extract subsequences
from genbank or PIR.

For example, I would like to be able to provide a keyword such as 'splice
site' and have the program search genbank and return with a list of sequence
names and the subsequence from each entry corresponding to my keyword.

Any leads would be appreciated....
Thanks,
---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder
Department of MCD Biology              ...making feet for childrens' shoes.
University of Colorado, Boulder
Boulder, Colorado 80309-0347
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------




More information about the Bioforum mailing list