'Content' vs. 'Signal'-- new terms?

Eric E. Snyder eesnyder at boulder.Colorado.EDU
Fri Nov 15 14:29:57 EST 1991


In the coding sequence identification literature, there are two
major conceptual approaches-- gene search by 'signal' and by 'content'.

I am looking for a way to refer to these strategies in terms of the 
properties of the sequence.   For instance, codon bias is a property that
is averaged over a large number of nucleotides.  In contrast, a splice 
site is defined in relation to a particular nucleotide.  

In analogy to physical chemistry, I would like to refer to these 
properties as 'intensive' or 'extensive', for signal and content respectively.  
Unfortunately, these terms don't quite fit.  Can anyone suggest an
alternative pair of adjectives that would express this idea?

Thanks!

---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder                            
Department of MCD Biology              ...making feet for childrens' shoes.
University of Colorado, Boulder   
Boulder, Colorado 80309-0347
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------



More information about the Bioforum mailing list