codon usage

[Eric E. Snyder]

On a related note:

Has anyone had any experience using different codon usage tables which
reflect the C + G content of the specific sequence being examined.  Since
codon usage tables are normally based on usage in genes of differing 
C + G contents, I wonder if better results might be obtained with tables 
derived from genes of specific base composition.  Does anyone have 
any thoughts on this matter?

---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder                            
Department of MCD Biology              ...making feet for childrens' shoes.
University of Colorado, Boulder   
Boulder, Colorado 80309-0347
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------