Codon usage tables

Eric E. Snyder eesnyder at boulder.Colorado.EDU
Thu Apr 1 13:59:51 EST 1993


tpryan at vax1.tcd.ie writes:


>Does anyone know of a database of codon usage tables and if so
>where it can be found? I am interested specifically in Rhizobiaceae.

>			John O'Brien.

The following codon usage tables can be found on nic.funet.fi
in the directory /pub/sci/molbio/databases/codon

Available via anonymosus ftp. 

***************** CLIP NIC READ.ME *******************

File Name	Organism/Organelle
==========	======================================================
ASN.COD		Aspergillus nidulans
ATH.COD		Arabidopsis thaliana
BLY.COD		Hordeum vulgare (Barley)
BMO.COD		Bombyx mori (Silk Moth)
BOV.COD		Bos taurus (Cow)
BSU.COD		Bacillus subtilis
CEL.COD		Caenorhabditis elegans
CHI.COD		Chironomus sp.
CHK.COD		Gallus sp. (Chicken)
DDI.COD		Dictyostelium discoideum
DRO.COD		Drosophila melanogaster
ECO.COD		Escherichia coli
HAM.COD		Cricetulus sp. & Mesocricetus sp. (Hamster)
HUM.COD		Homo sapiens
KPN.COD		Klebsiella pneumoniae
MAC.COD		Macaca sp
MUS.COD		Mus sp. (Mouse)
MZE.COD		Zea mays (Maize)
MZECP.COD	Zea mays chloroplast (Maize)
NEU.COD		Neurospora crassa
NGO.COD		Neisseria gonorrheae
PEA.COD		Pisum sativum (Pea)
PET.COD		Petunia sp.
PFA.COD		Plasmodium falciparum
PHV.COD		Phaseolus vulgaris (Lima bean)
POT.COD		Solanum tuberosum (Pototoe)
PSE.COD		Pseudomonas sp.
RAB.COD		Oryctolagus sp. (Rabbit)
RAT.COD		Rattus sp. (Rat)
RHM.COD		Rhizobium meliloti
RIC.COD		Oryza sativa (Rice)
SHP.COD		Ovis sp. (Sheep)
SLM.COD		Physarum polycephalum
SOY.COD		Glycine max (Soybean)
STA.COD		Staphylococcus aureus
STY.COD		Salmonella thphimurium
SUS.COD		Strongylocentrotus purpuratus
TOB.COD		Nicotiana tabacum (Tobacco)
TOBCP.COD	Nicotiana tabacum chloroplast (Tobacco)
TOM.COD		Lycopersicon esculentum (Tomato)
TRB.COD		Trypanosoma brucei
WHT.COD		Triticum aestivum (Wheat)


---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder                            
Department of MCD Biology              ...making feet for childrens' shoes.
University of Colorado, Boulder   
Boulder, Colorado 80309-0347
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------



More information about the Bioforum mailing list