Updated GenMark Gene Recognition Server Annoncement
James D. McIninch
gt1619a at prism.gatech.EDU
Mon Aug 16 09:29:51 EST 1993
--- GenMark Server *** ANOUNCEMENT
--- genmark at ford.gatech.edu
We are pleased to announce that the GenMark server, software and data,
has been updated. A number of new features have been added and many previously
available features have been updated.
The GenMark server provides an E-Mail based gene finding service using
the GenMark algorithm (based on non-stationary Markov chain models) which was
developped at the Georgia Institute of Technology (Atlanta, GA) and at the
Institute of Molecular Genetics (Moscow).
The GenMark server accepts messages containing DNA sequences in a very
simple format. The submitter may specify the nature of the algorithm used by
species name and specify parameters affecting the complexity of the analysis.
In its most simple form, a GenMark query may look like this:
% mail genmark at ford.gatech.edu
Subject: genmark
data
acatgcatcgatcatcagcatcagcatatacgatcagctacatcgatcatgaacgttacgtga
atctagctcagcatgcatcagtcagtcatgcatgcatgatgcatatgcatactgctatgcatc
atcgagctagcatacgatcgctcgccctagctaaagctagcatagcgatcg
.
EOT
Summary of features
-------------------------------------------------------------------------------
- List of DNA sequence regions predicted as protein-coding in a certain
frame.
- Optional detailed report on the GenMark evaulation of the coding poten-
tial of the sequence in the form of PostScript graphical output (to
print on a laser printer).
- NEW OPTION: Immediate sending of DNA sequence regions predicted as pro-
tein-coding to a BLAST server for sequence homology searches using the
BLAST algorithm (NCBI/NIH). BLAST results are sent directly to the
submitter.
- NEW OPTION: A new matrix is available permitting the analysis of human
sequences (currently not very sophisticted, exons shorter than 60bp
may be missed).
- NEW OPTION: Search for horizontally transferred genes and intervening
sequences in E. Coli as well as assessment of gene expression level.
(Using the default settings, the standard E. Coli information predicts
the coding potential of 96bp fragments with a 4% false negative rate
and a 3% false positive rate).
FOR MORE INFORMATION
-------------------------------------------------------------------------------
You may retrieve a copy of the new instructions and explanation of
features for using GenMark as well as an up to date list of matrices by send-
ing an E-Mail message with the word "instructions" in the subject or body of
the letter to:
genmark at ford.gatech.edu
If you would like to contact us personally, you may do so by sending
electronic mail to Dr. M. Borodovsky at:
mb56 at prism.gatech.edu
... or ot J. McIninch at:
gt1619a at prism.gatech.edu
(Dr. Borodovsky will be unavailable until August 18, 1993)
REFERENCES
-------------------------------------------------------------------------------
Borodovsky M, McIninch J. (1993) GENMARK: Parallel Gene Recognition for Both
DNA strands, Computers & Chemistry, 17, N2, 123-133.
Borodovsky M, McIninch J. (1993) Prediction of Gene Locations Using DNA Markov
Chain Models. Proceedings of the Seconf International Conference on Super-
computing Bioinformatics and Complex Genome Analysis. St. Petersberg, FL,
199, World Scientific, 231-248.
Borodovsky, M.Yu., Sprizhitsky, Yu.A., Golovanov, E.I., Alexandrov, A.A.,(1986)
Statistical Patterns in the Primary Structure of the Functional Regions of
the Escherichia Coli Genome. III. Computer Recognition of Protein Coding
Regions. Molecular Biology, 20, 1144-1150.
More information about the Bioforum
mailing list