Summer competition
Peter Rice
rice at embl-heidelberg.de
Mon Jun 7 05:14:20 EST 1993
No prizes, but a challenge to the net:
The following posting just appeared on rec.humor.funny. Of course it is
nonsense, but the task is to suggest a sequence that would make the
joke work after all.
Alternative genetic codes, translation exceptions, alternate splicing and
other phenomena will be accepted, as long as the final sequence(s) are in
standard code (but you can specify the "standard" you are assuming :-)
Similarly, any other stated language can be used, but an English translation
must be provided. (With luck I can find someone at EMBL who can check the
accuracy of the original :-)
The joke can be at the DNA, RNA or Protein level.
Ambiguity codes will be allowed, but all characters must be standard.
For example:
NCBI: Ambiguous protein sequence (B), possibly valid ambiguous DNA
(I=inosine, as used in sequencing to resolve compressions :-)
EMBL: Ambiguous protein sequence (B), invalid DNA sequence (E,L)
GENBANK: Ambiguous protein sequence (B), invalid DNA sequence (E)
DDBJ: Invalid sequence (J is not a DNA or protein code - unless it is in
Japanese, Finnish, or any other alphabet :-)
Please mail entries to me, and I will post the best in a couple of weeks.
The original posting sadly gave no clue to the origin of the joke.
>Dateline, National Institutes of Health, Feb. 1999:
>
>Human Genome Project scientists announced a significant breakthrough
>in cracking the genetic code today. They disclosed that they have
>solved the long-standing problem of why only a small fraction of the
>DNA strand is actually used by the cell to code for proteins, while
>the rest seems to be just unused "junk".
>
>The crux of the discovery was the amino acid sequence:
>
>ATGCATGGACTGATCTAGTCATGCTGACTGGTACATACCGAATCAGTACCATGGACATATACAGTAC
>GTTACCGTGACCTCAGTCAATGGCCATCTCGTGACTTCGATCTACTGAAATCCATGATCATAGCATG
>ATCAGTCCTACGTAGCATGCAATGCATGCATATAGCATATCACATTATACGACTACGTACATGACGT
>ACCGTAGTACATCAGG
>
>which was found to decode to:
>
>"this space intentionally left blank."
-----------------------------------------------------------------------------
Peter Rice, EMBL | Post: Computer Group
| European Molecular
Internet: Peter.Rice at EMBL-Heidelberg.DE | Biology Laboratory
| Postfach 10-2209
Phone: +49-6221-387247 | W-6900 Heidelberg
Fax: +49-6221-387306 | Germany
More information about the Bioforum
mailing list