=====GC==RICH==PRIMER====

Calvino Ka-wing Cheng ckwcheng at acs4.acs.ucalgary.ca
Fri Jun 21 14:28:01 EST 1996


Hi.

	I'm doing PCR for site specific mutagenesis and the
region of the gene we are trying to mutagenise is GC rich in the
area that encodes for the amino acid residue.  I was wondering
if...

1.  Someone can input my two primers into an OLIGO program to see
if they will dimerise....

primer 1  ->    5' GATCAGXCTATGTGGCGGATGAGCG 3'
                          T
                          A

primer 2 ->    3' ACCTCACTGGCCGTCAATAGACCTT 5'

2.  Someone (it can be the same person) can check if the primers
will fold up on themselves (ie. secondary structure....hairpins
etc)

3.  If this doesn't work, then I was wondering if anyone can tell
me where to get some more information (ie. shareware I may able
to obtain...)

4.  As an aside, I did PCR with these primers but was unable to
get any product.  The first time, though, I did get a TINY TINY
amount but not enough to do a proper transformation with.

YOUR ANTICIPATED HELP IS VERY APPRECIATED.  (I've had many
sleepless nights for the past few months!)


ThankyouhankyouThankyouThankyouThankyouThankyou

Sincerely,

Calvino Cheng



More information about the Bioforum mailing list