Cosmid Vector Sequences

paul kayne kayne at caltech.edu
Wed Nov 2 19:17:27 EST 1994


i agree, vector sequences should be easier to come by. until then
-we'll always have each other! this is probably to big to post, but it
does seem like a good use of the internet. this should be the correct
sequence of lorist 6. hope it helps.

paul kayne
kayne at caltech.edu



GGATCGCGGCCGCAGTACTGGATCCTATGTATTCTATAGTGTCACCTAAATCGTATGTGTATGATACATAAG
GTTATGTATTAATTGTAGCCGCGTTCTAACGACAATATGTACAAGCCTAATTGTGTAGCATCTGGCTTACTG
AAGCAGACCCTATCATCTCTCTCGTAAACTGCCGTCAGAGTCGGTTTGGTTGGACGAACCTTCTGAGTTTCT
GGTAACGCCGTCCCGCACCCGGAAATGGTCAGCGAACCAATCAGCAGGGTCATCGCTAGAAATCATCCTTAG
CGAAAGCTAAGGATTTTTTTTATCTGAATTCTAGCCAGATCCCCGGGCGAGCTGCGGCCTGATTTATGCTGG
TTACTGTTGCGCCTGTTAGCGCGGCAACGTCCGGCGCACAGAAGCTATTATGCGTCCCCAGGTAATGAATAA
TTGCCTCTTTGCCCGTCATACACTTGCTCCTTTCAGTCCGAACTTAGCTTTGATTTCTGCGATCTTCGCCAG
AGCCTGTGCACGATTTAGAGGTCTACCGCCCATGACAGGAAGTTGTTTTACTGGTTCAGGGATCGCCTCACC
ACGGTTAATTCTCGCAGTCATATGGACAAGCTCATCTGCGGCCTTACGGCGTAATTCCGCATCAGTAAGCGC
ATTGGCCCGCATGTTCTGATACAGGTTGGTAACCAGCCAGTAGTGCGCGTTTGATTTCCACGGATAAGACTC
CGCATCCGGATACAGGCCTCGCTTCCGGCAATACTCGTAAACCATATCAACCAGCTCGCTGACGTTTGGCAG
TCCGGCGGTAACGGATGCTTCTTCCCGGCACCATGCAACAAACTGCCCGGGTGATGGCAGAAATGGTCGATT
CTGCCGACGGGCTACGCGCATTCCTGCGTTAACCTGTTCCATCGTGGTGATCCCGTTTTCCCGAAAAGCCAG
AACCCACTGGCGACGGATTTCGTTCACTTCGTTCTGGTCACGGTTAGCCAGGCTCGCCGGGAAAGTTGCCAG
TAACTGGCTGAACACACCGTTGATGATCTGCGCTACCTGCTGTACCTGCGGCTTTTCGTCGTACTGTTCCGG
CATGTTGTTGGCGATCCGACGCATCTGCTCACGGTCAAAGTTAACCATCTGTGCGGCGATGTTTTTCATAGA
TCCACCCCGTAAATCCAGTCTGTGTTTGTCAGGTCGAGTTTTGGTTTGCTGGCTGTCACGCCTGCCTGTTGC
TTGTTACGGTTGATTTCGAGTTGGGTCCACTTATCGCGGAGTTTGGCCGGGCTCAGCACGTTACCGGACCAG
AAGTTGTCCTGGCATGCCCAGCGGAACAGCACACACATGTCGCGGTGGTTACGTCCGTCACGTTCACGCATC
AGGCGGATATCGTTAGCCCACCCAGCAAAATTCGGTTTTCTGGCTGATGGTGCGATAGTCTTCACCATGTCA
AACATCCACTCTGCGGCGGTCAGGTCTTCTGCTGTCCCCCACTTGCTGCCGCTCTGAATTGCAGCATCCGGT
TTCACCACAGAAAGGTCGTTTTCTGGCTGGTCAGAGGATTCGCCAGAATTCTCTGACGAATAATCTTTTCTT
TTTTCTTTTGTAATAGTGTCTTTTGTGTCCCCCTGTTTTGAGGGATAGCAATCCCCCAATTTGAGGGATGTT
TTATCCCTCGTTTTAGGGGATTTTCCCTCGTTTTGAGGGATGCACCATTCTGAGATGTTTTTATTTGGTCCA
AACATGCCGCCTTGCTGCTTGATAATATTCATTCTGACGAGTTCTAACTTGGCTTCATTGCACCGTTTGACA
GGTAACTTTGTAATCTCGCTAAGTTGAGAATCGGTGATTCTGTCCATTGGTTTATTCCACCCATAGGTTTTA
CGCAGAATGGCAAGCAGCACTTTAAACTGTCGCTTGGTCAGATCTGCGCCCGAATAAGCCTCAAGCAGCATA
TTTGATAGTCTGGCGTAACCATCATCGAGATCTGCCACATTACGCTCCTGTCCGGCAAAGTTACCTCTGCCG
AAGTTGAGTATTTTTGCTGTATTTGTCATAATGACTCCTGTTGATAGATCCAGTAATGACCTCAGAACTCCA
TCTGGATTTGTTCAGAACGCTCGGTTGCCGCCGGGCGTTTTTTATTGGTGAGAATCGCAGCAACTTGTCGCG
CCAATCGAGCCATGTCGTCGTCAACGACCCCCCATTCAAGAACAGCAAGCAGCATTGAGAACTTTGGAATCC
AGTCCCTCTTCCACCTGCTGATCTGCGACTTATCAACGCCCACAGCTTCCGCTGTCTTCTCAGTTCCAAGCA
TTGCGATTTTGTTAAGCAACGCACTCTCGATTCGTAGAGCCTCGTTGCGTTTGTTTGCACGAACCATATGTA
AGTATTTCCTTAGATAACAATTGATTGAATGTATGCAAATAAATGCATACACCATAGGTGTGGTTTAATTTG
ATGCCCTTTTTCAGGGCTGGAATGTGTAAGAGCGGGGTTATTTATGCTGTTGTTTTTTTGTTACTCGGGAAG
GGCTTTACCTCTTCCGCATAAACGCTTCCATCAGCGTTTATAGTTAAAAAAATCTTTCGGCCTGCATGAATG
GCCTTGTTGATCGCGCTTTGATATACGCCGAGATCTTTAGCTGTCTTGGTTTGCCCAAAGCGCATTGCATAA
TCTTTCAGGGTTATGCGTTGTTCCATACAACCTCCTTAGTACATGCAACCATTATCACCGCCAGAGGTAAAA
TAGTCAACACGCACGGTGTTAGATATTTATCCCTTGCGGTGATAGATTTAACGTATGAGCACAAAAAAGAAA
CCATTAACACAAGAGCAGCTTGAGGACGCACGTCGCCTTAAAGCAATTTATGAAAAAAAGAAAAATGAACTT
GGCTTATCCCAGGAATCTGTCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATGGC
ATCAATGCATTAAATGCTTATAACGCCGCATTGCTTACAAAAATTCTCAAAGTTAGCGTTGAAGAATTTAGC
CCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGTAT
GAGTACCCTGTTTTTTCTCATGTTCAGGCAGGGATGTTCTCACCTGAGCTTAGAACCTTTACCAAAGGTGAT
GCGGAAATGGGTAAGCACAACCAAAAAAGCCAGTGATTCTGCATTCTGGCTTGAGGTTGAAGGTAATTCCAT
GACCGCACCAACAGGCTCCAAGCCAAGCTAGCGAATTCTCATGTTTGACAGCTTATCATCGATATGCTTTAA
TGCGGTAGTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCT
CCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCC
GTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAA
CTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTT
GTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTT
GCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGC
CCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAG
GATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCC
GACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTT
TCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGAT
ATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCG
CAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGATGTCGACAGCC
CGCCTAATGAGCGGGCTTTTTTTTCCTGAGGCTGGACGACCTCGCGGAGTTCTACCGGCAGTGCAAATCCGT
CGGCATCCAGGAAACCAGCAGCGGCTATCCGCGCATCCATGCCCCCGAACTGCAGGAGTGGGGAGGCACGAT
GGCCGCTTTGGTCGGATCAATTCGCGCGACGGATCGATCCGGGCAACGTTGTTGCCATTGCTGCAGGGGGGG
GGGGGGGGGGGGGGGGGGGTTGACTTCCATTGTTCATTCCACGGACAAAAACAGAGAAAGGAAACGACAGAG
GCCAAAAAGCCTCGCTTTCAGCACCTGTCGTTTCCTTTCTTTTCAGAGGGTATTTTAAATAAAAACATTAAG
TTATGACGAAGAAGAACGGAAACGCCTTAAACCGGAAAATTTTCATAAATAGCGAAAACCCGCGAGGTCGCC
GCCCCGTAACCTGTCGGATCACCGGAAAGGACCCGTAAAGTGATAATGATTATCATCTACATATCACAACGT
GCGTGGAGGCCATCAAACCACGTCAAATAATCAATTATGACGCAGGTATCGTATTAATTGATCTGCATCAAC
TTAACGTAAAAACAACTTCAGACAATACAAATCAGCGACACTGAATACGGGGCAACCTCATGTCAACCCCCC
CCCCCCCCCCCCCCCCCCCCTGCAGGCGGAGAACTGGTAGGTATGGAAGATCTCTAGAGAATTCAAAAAAAG
CCCGCTCATTAGGCGGGCTAATTCGAGCTCGCCCGGGGATCGATCCTCTAGAGTCCTGATGCGGTATTTTCT
CCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATA
GTTAAGCCAGTATATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACAC
CCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGA
GCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCCCAGCTGGCTTATCGAAATTAATA
CGACTCACTATAGGGAGACCGGAAGCTTA



More information about the Celegans mailing list