Summary for SL1 PCR conditions'
burglin at ubaclu.unibas.ch
burglin at ubaclu.unibas.ch
Thu Aug 24 15:24:51 EST 1995
Hi,
here is a summary of responses I got for the SL1 primer conditions.
Thomas Burglin
------------------------
I have used the complete SL1 sequence (plus a 5' end restriction site)
in PCR my hyb. temp was
55 degrees for 30 seconds. It worked well and was very specific. However,
I used a reverse transcribed template that was reverse transcribed from
only about 200-300 nt's away from the SL so I was pretty confident that it
was there.
Good Luck!
Terese Rakow
The Scripps Research Inst.
--------------
I use SL1 primers a lot here both for library amplification and RT-PCR.
I use modified SL1's which have re sites at the 5' end (and also changes in
the SL1 itself to remove stop codons (lower case bases)- I've been making
expression libraries).
Sequences:
RESTRICTION SITES GCTCTAGAGCGGCCGC
Xba1 Not1
SL1 GGTTTAATTACCCAAGTTTGAG
SL1Ä1 GCTCTAGAGCGGCCGCGGTTTAgTTACCCAAGTTTGAG 38
SL1Ä2 GCTCTAGAGCGGCCGCGGGTTTAATTACCCAAGTTgGAG 39
SL1Ä3 GCTCTAGAGCGGCCGCGGGGTTTAATTACCCAAGTTgGAG 40
I use these at 100 ng per 100 µl reaction,
and use an annealing temp of 57-60¡C unless using a degenerate or dT oligo
downstream when the temp is dictated by that oligo.
For RT PCRs I use a Perkin Elmer kit, but split the initial RT (20 µl) into
up to 8 separate aliquots for PCR.
For library PCRs I use 10 µl of library (neat phage at ~10e9 pfu/ml)
We have also used an SL2 oligo (like SL1Ä1) with similar success.
Mark
Dr. Mark Blaxter
has moved as of August 1st 1995
email Mark.Blaxter at ed.ac.uk
Institute of Cell, Animal and Population Biology
Ashworth Laboratories, King's Buildings
University of Edinburgh
West Mains Road
EDINBURGH EH9 3JT
United Kingdom
Fax : (+44) 131 650 5450
phone: (+44) 131 650 6760
----------
My experience with using SL1 as the means to get the 5'-end of a cDNA is
that one has to be wary of what one gets out of the RT-PCR. It appears
that by PCR, one can find SL1 spliced to bonafide cis acceptor sites,
so you have to be careful using this approach. I would suggest checking
that you have the real 5-end by some other means, as well; say RNase
protection, or primer extension. However, I have managed to clone the
5'-ends of several cDNAs (and verified them) using SL1. I use standard
PCR conditions (55 degrees), but the primer I use has a modified 5'-end to
include an EcoRI site.
Jonathan Pettitt
------------------
I thought you might be interested to know that I used a primer against
SL1 to fish out the potential 5' end of the lin-22 cDNA. I first used
oligo dT to reverse transcribe total RNA from wt and mutants. I then
set up a PCR reaction using SL1 and an internal primer: 50 ul rxns using
50 pmol of each primer, hot start 94 deg C, then 1' at 94, 1' at 55, and
3' at 72 per cycle. I went 40 cycles total. I could not see any sharp
bands after this, so I repeated another 30 cycles with SL1 and a second
internal primer, same conditions. I think that lin-22 is a fairly rare
message since I could not find it in 2 million clones of the Barstead
library, 1 million clones of the Martin 1-2 kb library, or 1 million of
the Martin 2-3 kb library. My luck with Northerns is also not too stellar
(ie. one possible message in 2 ug of poly A+ on film for 2 weeks with
screens). Anyway, the point is that you may have much better luck with
your message and not need so many rounds of PCR. I should also tell you
that the distance between my internal primer and SL1 was fairly short
(about 200 bp), and this may also be an important consideration.
Good luck with finding your clone! I consider myself fairly lucky in
getting the 5' end, but the 3' end has been evil....
Lisa Wrischnik
wrisch at cgl.ucsf.edu
-----------------------
More information about the Celegans
mailing list