IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

method of choice to identify DNA bending, kinking or any other deformation?

newera at plaza.snu.ac.kr newera at plaza.snu.ac.kr
Fri Feb 21 14:43:14 EST 1997


I have a DNA binding protein(mw 6100), presumed to be a dimer and not to need any cofactors. It suppresses the replication of a certain gene by binding to its binding sequence overlaped by the promoter site of the gene. 
Its binding DNA sequence is much highly AT-rich and has two palindromic sites, each consisting of 9 base pairs. 12 base pairs exist between the palindromic sites.

--------     ..
TGTTTTTTATGTTAAAGTGAAAAAAACA
ACAAAAAATACAATTTCACTTTTTTTGT
                    --------

I have some questions in studying its protein-induced DNA defomation:

1. Does it have any possiblity of inducing DNA deformaiton?
2. What a handy method can elucidate whether it induces DNA deformation or not?

Gel retardation assay is under consideration although I think it is suitable for only indentification of DNA bending.

Could you advise me on this matter?

--
email 	: newera at plaza.snu.ac.kr
address :
  Lee, Ji Hyun
  Laboratory of Physical Pharmacy(Prof. Lee, Bong Jin)

  Seoul National University
  College of Pharmacy		  
  Shinlim-Dong, Kwanak-Gu
  Seoul 151-742, Korea.




More information about the Cellbiol mailing list

Send comments to us at biosci-help [At] net.bio.net